Glyma10g39521 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g39521): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g39521): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g39521

Feature Type:	gene_model
Chromosome:	Gm10
Start:	47183399
stop:	47185433
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g39521

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G26340	AT	Annotation by Michelle Graham. TAIR10: Major facilitator superfamily protein \| chr5:9243851-9246994 REVERSE LENGTH=526	SoyBase	E_val: 2.00E-148	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009737	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus	SoyBase	N/A	ISS
GO:0015749	GO-bp	Annotation by Michelle Graham. GO Biological Process: monosaccharide transport	SoyBase	N/A	ISS
GO:0016310	GO-bp	Annotation by Michelle Graham. GO Biological Process: phosphorylation	SoyBase	N/A	ISS
GO:0043090	GO-bp	Annotation by Michelle Graham. GO Biological Process: amino acid import	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009506	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0005351	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sugar:hydrogen symporter activity	SoyBase	N/A	ISS
GO:0005358	GO-mf	Annotation by Michelle Graham. GO Molecular Function: high-affinity hydrogen:glucose symporter activity	SoyBase	N/A	ISS
GO:0009679	GO-mf	Annotation by Michelle Graham. GO Molecular Function: hexose:hydrogen symporter activity	SoyBase	N/A	ISS
GO:0015144	GO-mf	Annotation by Michelle Graham. GO Molecular Function: carbohydrate transmembrane transporter activity	SoyBase	N/A	ISS
GO:0015145	GO-mf	Annotation by Michelle Graham. GO Molecular Function: monosaccharide transmembrane transporter activity	SoyBase	N/A	ISS
PTHR24063	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24063:SF214	Panther		JGI		ISS
PF00083	PFAM	Sugar (and other) transporter	JGI		ISS
UniRef100_G7K2C5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Hexose transporter n=1 Tax=Medicago truncatula RepID=G7K2C5_MEDTR	SoyBase	E_val: 3.00E-157	ISS
UniRef100_UPI000233CC37	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233CC37 related cluster n=1 Tax=unknown RepID=UPI000233CC37	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma10g39521

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g39521 not represented in the dataset	Glyma10g39521 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g39521 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma10g39521

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g39521

Limit To All Plant Sequences

>Glyma10g39521.1   sequence type=CDS   gene model=Glyma10g39521   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GCAGTTCCAGATTTTCTTTCAGAGATCGCACCTTCAAGAATTCATGGAGCATTGAATATACTGTCCCAGCTGAATATCACCCTTGGCATTCACTTTGCCAACCTGGTCAACTATGCCACCAAAGTAAGTGGATGGGGATGGAGGCTATCTCTAGGTTTGGGTGGTTTACCAGCGTTGCTTCTGACGTTGGGGGCTTTCTTGCTGGTGGACACACCAAATAGTCTGATCGAGCGTGGTCACTTGGAAGAAGGAAAAGCTGTGCTGAGAAAGATTCGTGGCATTGACAACATTGAACCTGAGTTCTTGGAGCTACTTGAAGCAAGTCATGTGGCTAAAGGAGTCAAGCACCCTTTCAGGAATATCCTCAAGGGCAGGAACAGACCGCAACTCGTCATTTCCATTGCTCTGCAGGTTTTTCAGCAGTTCACTGGCAGCAATGCCATAATGTTTTATGCCCCAGTTCTGTTCAACACATTAGGATTCAAGAACGATGCTTCTGTCTACTCTGCGGTGATTACTGGAGCCATTAACATGCTCTCAACTGTTGTATCAATCTATTCGAGCATTCAGATGTTCTTGTCACATGTTGTGATTGCAGTTGTAATGGGAATGAAGGTGAAGGACCATTCTGAGGACCTCTCAAAGAGTTATGCTTTGCTTGTGGTTGTGATGGTTTGCATTTTTGTGGCTGCATTTGCATGGTCACGTGGGCCTCTTGGGCAAGCTTTGTCCGTGTGTGTCAACTTCCTCTTCACATTTGTCATTGGACAAGCCGTTCTGTCATTGTTGTGTCTCTTCAAGTTTGGCATGTTCTTCTTGGGATGGATCTTGATCATGTTCACCTTTGTCTTTTTCCTTCTCCCCGAGACAAAGAAGGTTCCCGTTGAAGAAATGACGGAGAGA

Predicted protein sequences of Glyma10g39521

Limit To All Plant Sequences

>Glyma10g39521.1   sequence type=predicted peptide   gene model=Glyma10g39521   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AVPDFLSEIAPSRIHGALNILSQLNITLGIHFANLVNYATKVSGWGWRLSLGLGGLPALLLTLGAFLLVDTPNSLIERGHLEEGKAVLRKIRGIDNIEPEFLELLEASHVAKGVKHPFRNILKGRNRPQLVISIALQVFQQFTGSNAIMFYAPVLFNTLGFKNDASVYSAVITGAINMLSTVVSIYSSIQMFLSHVVIAVVMGMKVKDHSEDLSKSYALLVVVMVCIFVAAFAWSRGPLGQALSVCVNFLFTFVIGQAVLSLLCLFKFGMFFLGWILIMFTFVFFLLPETKKVPVEEMTER

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain