Glyma10g38080 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g38080

Feature Type:	gene_model
Chromosome:	Gm10
Start:	45966695
stop:	45969627
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g38080

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G23750	AT	Annotation by Michelle Graham. TAIR10: Remorin family protein \| chr5:8010004-8011453 REVERSE LENGTH=201	SoyBase	E_val: 8.00E-69	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0042546	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell wall biogenesis	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
PF03763	PFAM	Remorin, C-terminal region	JGI		ISS
PF03766	PFAM	Remorin, N-terminal region	JGI		ISS
UniRef100_C6SVC8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SVC8_SOYBN	SoyBase	E_val: 7.00E-131	ISS
UniRef100_G8A207	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Remorin n=1 Tax=Medicago truncatula RepID=G8A207_MEDTR	SoyBase	E_val: 9.00E-79	ISS

Expression Patterns of Glyma10g38080

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g38080

Paralog	Evidence	Comments
Glyma20g29740	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g38080 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g236300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g38080

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g38080

Limit To All Plant Sequences

>Glyma10g38080.1   sequence type=CDS   gene model=Glyma10g38080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAGAGGAGCAATCCAAAAAGGTGGCTGAGACTGAGAGTTTTCCCTCTAATCCTGCACCTGAACCTGTTGTTGTTCCAAAGGAGGATGTGGCAGAGGAGAAATCTGTAATTCCACAACCCTCTCCCTCTCCTGCTGATGAGTCCAAAGCTCTTGTCATAGTTGAGAAGACTAGTGAAGTTGCTGAAGAGAAACCGATTGAGGGGTCTGTGAACCGAGATGCTGTGCTTGCAAGAGTTGCAACCGAGAAGAGGCTGTCACTAATCAAAGCATGGGAAGAAAGTGAAAAGTCCAAAGCAGATAACAAGTCTCACAAAAAGCTTTCAGCCATTTCAGCATGGGAAAACAGCAAGAAAGCTGCAGCGGAGGCAGAATTGAGAAAGATTGAAGAACAACTGGAGAAGAAAAAAGCAGAATATGGAGAGAAATTGAAAAACAAAATAGCTACAATCCACCGAGAAGCTGAAGAAAAGAGAGCATTTATTGAGGCCCAAAAAGGGGAAGAATTCTTGAAGGCAGAGGAGACTGCTGCAAAGTACAGGGCAACTGGAACAGCCCCAACGAAACTCTTTGGTTGTTTCTAA

Predicted protein sequences of Glyma10g38080

Limit To All Plant Sequences

>Glyma10g38080.1   sequence type=predicted peptide   gene model=Glyma10g38080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTEEQSKKVAETESFPSNPAPEPVVVPKEDVAEEKSVIPQPSPSPADESKALVIVEKTSEVAEEKPIEGSVNRDAVLARVATEKRLSLIKAWEESEKSKADNKSHKKLSAISAWENSKKAAAEAELRKIEEQLEKKKAEYGEKLKNKIATIHREAEEKRAFIEAQKGEEFLKAEETAAKYRATGTAPTKLFGCF*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain