SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma10g37460

Feature Type:gene_model
Chromosome:Gm10
Start:45452410
stop:45454348
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G52830AT Annotation by Michelle Graham. TAIR10: WRKY DNA-binding protein 27 | chr5:21410996-21412218 FORWARD LENGTH=348 SoyBaseE_val: 8.00E-58ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007263GO-bp Annotation by Michelle Graham. GO Biological Process: nitric oxide mediated signal transduction SoyBaseN/AISS
GO:0009739GO-bp Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
PF03106PFAM WRKY DNA -binding domain JGI ISS
UniRef100_G7IDY1UniRef Annotation by Michelle Graham. Most informative UniRef hit: WRKY transcription factor n=1 Tax=Medicago truncatula RepID=G7IDY1_MEDTR SoyBaseE_val: 5.00E-100ISS
UniRef100_UPI000233C7B9UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C7B9 related cluster n=1 Tax=unknown RepID=UPI000233C7B9 SoyBaseE_val: 0ISS

LocusGene SymbolProtein Name
WRKY2 WRKY Transcription Factor

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma20g30290 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g230200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma10g37460.1   sequence type=CDS   gene model=Glyma10g37460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGAGGACTGGGATCTCTTTGCCATCGTGAGAAGCTGCCAATCAGCCACCACAACAATTCCACAAACCACCACCAATAATACTTCCTCTTCCTTAGTTACTTCCACTATCAAGGAAGAAATATATGATGCATTTTCCTCTCCCAATATAGTGCCACCCAATACCAATGAGTTTCAAGAGCTACACCAATTGTTCACACCCTTTAACCCCACCAACAACACTAGTGCTCCGGGCATCAATCCCAATTCCCCTTATTTTGCAGAACAAGAAAGCCAGCAAATCAGTGAACACCTTCATATTTGGCCTCATTTTGTGCCAGAACAGTCTTCCACTCCCAGTTTCAATAGATTCCATGACCAACAACAACAGCAACAGATCAATCAACTACAGGCACTTCAGAAACACGAATTTCGACTACCCCAGAACATTTCTCCCACAGTTTCACCAAACGCACAACCTCAAACACCCAAATCAAGAAAAAGAAAAAGCCAACAGAAGAAGATGGTGTGCCATGTAACCGCAGATAACCTCTCAGCAGATTTGTGGGCATGGCGAAAATACGGACAAAAACCAATTAAGGGTTCTCCATATCCAAGGAATTACTATAGGTGCAGCAGTTCCAAAGGTTGTATGGCTCGAAAACAAGTCGAACGGAGTAACACTGAACCCGACATGTTCGTCGTTACGTACACCGGAGACCACTCGCATCCCCGGCCAACTCACCGGAACTCGCTCGCCGGAAGTACCCGGAGTAAGACTCTGGTAACCAATCCGCCACCGTCACCTGGGTCACTCTCCTGCTTCCAAGCCACCCCTTTTTCTTCTTCTTCTTCATCGCCACCACACTCTCCAACGTCGCCGGAGGAAGATCCACGGAAACCGCCGATTTAG

>Glyma10g37460.1   sequence type=predicted peptide   gene model=Glyma10g37460   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEDWDLFAIVRSCQSATTTIPQTTTNNTSSSLVTSTIKEEIYDAFSSPNIVPPNTNEFQELHQLFTPFNPTNNTSAPGINPNSPYFAEQESQQISEHLHIWPHFVPEQSSTPSFNRFHDQQQQQQINQLQALQKHEFRLPQNISPTVSPNAQPQTPKSRKRKSQQKKMVCHVTADNLSADLWAWRKYGQKPIKGSPYPRNYYRCSSSKGCMARKQVERSNTEPDMFVVTYTGDHSHPRPTHRNSLAGSTRSKTLVTNPPPSPGSLSCFQATPFSSSSSSPPHSPTSPEEDPRKPPI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo