Report for Sequence Feature Glyma10g37460
Feature Type: gene_model
Chromosome: Gm10
Start: 45452410
stop: 45454348
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma10g37460
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G52830 AT
Annotation by Michelle Graham. TAIR10: WRKY DNA-binding protein 27 | chr5:21410996-21412218 FORWARD LENGTH=348
SoyBase E_val: 8.00E-58 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0007263 GO-bp
Annotation by Michelle Graham. GO Biological Process: nitric oxide mediated signal transduction
SoyBase N/A ISS
GO:0009739 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to gibberellin stimulus
SoyBase N/A ISS
GO:0042742 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to bacterium
SoyBase N/A ISS
GO:0045892 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
GO:0043565 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding
SoyBase N/A ISS
PF03106 PFAM
WRKY DNA -binding domain
JGI ISS
UniRef100_G7IDY1 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: WRKY transcription factor n=1 Tax=Medicago truncatula RepID=G7IDY1_MEDTR
SoyBase E_val: 5.00E-100 ISS
UniRef100_UPI000233C7B9 UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233C7B9 related cluster n=1 Tax=unknown RepID=UPI000233C7B9
SoyBase E_val: 0 ISS
Proteins Associated with Glyma10g37460
Locus Gene Symbol Protein Name
WRKY2 WRKY Transcription Factor
Expression Patterns of Glyma10g37460
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma10g37460
Paralog Evidence Comments
Glyma20g30290 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma10g37460 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.10g230200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma10g37460
Coding sequences of Glyma10g37460
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma10g37460.1 sequence type=CDS gene model=Glyma10g37460 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCTGAGGACTGGGATCTCTTTGCCATCGTGAGAAGCTGCCAATCAGCCACCACAACAATTCCACAAACCACCACCAATAATACTTCCTCTTCCTTAGTTACTTCCACTATCAAGGAAGAAATATATGATGCATTTTCCTCTCCCAATATAGTGCCACCCAATACCAATGAGTTTCAAGAGCTACACCAATTGTTCACACCCTTTAACCCCACCAACAACACTAGTGCTCCGGGCATCAATCCCAATTCCCCTTATTTTGCAGAACAAGAAAGCCAGCAAATCAGTGAACACCTTCATATTTGGCCTCATTTTGTGCCAGAACAGTCTTCCACTCCCAGTTTCAATAGATTCCATGACCAACAACAACAGCAACAGATCAATCAACTACAGGCACTTCAGAAACACGAATTTCGACTACCCCAGAACATTTCTCCCACAGTTTCACCAAACGCACAACCTCAAACACCCAAATCAAGAAAAAGAAAAAGCCAACAGAAGAAGATGGTGTGCCATGTAACCGCAGATAACCTCTCAGCAGATTTGTGGGCATGGCGAAAATACGGACAAAAACCAATTAAGGGTTCTCCATATCCAAGGAATTACTATAGGTGCAGCAGTTCCAAAGGTTGTATGGCTCGAAAACAAGTCGAACGGAGTAACACTGAACCCGACATGTTCGTCGTTACGTACACCGGAGACCACTCGCATCCCCGGCCAACTCACCGGAACTCGCTCGCCGGAAGTACCCGGAGTAAGACTCTGGTAACCAATCCGCCACCGTCACCTGGGTCACTCTCCTGCTTCCAAGCCACCCCTTTTTCTTCTTCTTCTTCATCGCCACCACACTCTCCAACGTCGCCGGAGGAAGATCCACGGAAACCGCCGATTTAG
Predicted protein sequences of Glyma10g37460
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma10g37460.1 sequence type=predicted peptide gene model=Glyma10g37460 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAEDWDLFAIVRSCQSATTTIPQTTTNNTSSSLVTSTIKEEIYDAFSSPNIVPPNTNEFQELHQLFTPFNPTNNTSAPGINPNSPYFAEQESQQISEHLHIWPHFVPEQSSTPSFNRFHDQQQQQQINQLQALQKHEFRLPQNISPTVSPNAQPQTPKSRKRKSQQKKMVCHVTADNLSADLWAWRKYGQKPIKGSPYPRNYYRCSSSKGCMARKQVERSNTEPDMFVVTYTGDHSHPRPTHRNSLAGSTRSKTLVTNPPPSPGSLSCFQATPFSSSSSSPPHSPTSPEEDPRKPPI*