Report for Sequence Feature Glyma10g34760
Feature Type: gene_model
Chromosome: Gm10
Start: 42934419
stop: 42936393
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma10g34760
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT1G25560 AT
Annotation by Michelle Graham. TAIR10: AP2/B3 transcription factor family protein | chr1:8981891-8982976 REVERSE LENGTH=361
SoyBase E_val: 1.00E-128 ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0009873 GO-bp
Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway
SoyBase N/A ISS
GO:0030003 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis
SoyBase N/A ISS
GO:0048573 GO-bp
Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering
SoyBase N/A ISS
GO:0070838 GO-bp
Annotation by Michelle Graham. GO Biological Process: divalent metal ion transport
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
PF00847 PFAM
AP2 domain
JGI ISS
PF02362 PFAM
B3 DNA binding domain
JGI ISS
UniRef100_Q45EZ4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: RAV-like DNA-binding protein n=1 Tax=Glycine max RepID=Q45EZ4_SOYBN
SoyBase E_val: 0 ISS
UniRef100_Q45EZ4 UniRef
Annotation by Michelle Graham. Best UniRef hit: RAV-like DNA-binding protein n=1 Tax=Glycine max RepID=Q45EZ4_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma10g34760
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma10g34760
Paralog Evidence Comments
Glyma20g32730 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma10g34760 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.10g204400 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma10g34760
Coding sequences of Glyma10g34760
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma10g34760.1 sequence type=CDS gene model=Glyma10g34760 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGATGGAGGCTGTGTCACAGACGAAACCACCACATCCAGCGACTCTCTTTCCGTTCCGCCGCCCAGCCGCGTCGGCAGCGTTGCAAGCGCCGTCGTCGACCCCGACGGTTGTTGCGTTTCCGGCGAGGCCGAATCCCGGAAACTCCCTTCGTCGAAATACAAAGGCGTGGTGCCGCAACCGAACGGTCGCTGGGGAGCTCAGATTTACGAGAAGCACCAGCGCGTGTGGCTCGGCACTTTCAACGAGGAAGACGAAGCCGCCAGAGCCTACGACATCGCCGCGCTGCGCTTCCGCGGCCCCGACGCCGTCACCAACTTCAAGCCTCCCGCCGCCTCCGACGACGCCGAGTCCGAGTTCCTCAACTCGCATTCCAAGTTCGAGATCGTCGACATGCTCCGCAAGCACACCTACGACGACGAGCTCCAGCAGAGCACGCGCGGTGGTAGGCGCCGCCTCGACGCTGACACCGCGTCGAGCGGTGTGTTCGACGCGAAAGCGCGTGAGCAGCTGTTCGAGAAAACGGTTACGCCGAGCGACGTCGGGAAGCTGAATCGATTAGTGATACCGAAGCAGCACGCGGAGAAGCACTTTCCGTTAAGCGGATCCGGCGACGAAAGCTCGCCGTGCGTGGCGGGGGCTTCGGCGGCGAAGGGAATGTTGTTGAACTTTGAGGACGTTGGAGGGAAAGTGTGGCGGTTTCGTTACTCTTATTGGAACAGTAGCCAGAGCTACGTGCTTACCAAAGGATGGAGCCGGTTCGTTAAGGAGAAGAATCTTCGAGCCGGTGACGCGGTTCAGTTCTTCAAGTCGACCGGACCGGACCGGCAGCTATATATAGACTGCAAGGCGAGGAGTGGTGAGGTTAACAATAATGCTGGCGGTTTGTTTGTTCCGATTGGACCGGTCGTTGAGCCGGTTCAGATGGTTCGGCTTTTCGGGGTCAACCTTTTGAAACTACCCGTACCCGGTTCGGATGGTGTAGGGAAGAGAAAAGAGATGGAACTGTTTGCATTTGAATGTTGCAAGAAGTTAAAAGTAATTGGAGCTTTGTAA
Predicted protein sequences of Glyma10g34760
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma10g34760.1 sequence type=predicted peptide gene model=Glyma10g34760 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MDGGCVTDETTTSSDSLSVPPPSRVGSVASAVVDPDGCCVSGEAESRKLPSSKYKGVVPQPNGRWGAQIYEKHQRVWLGTFNEEDEAARAYDIAALRFRGPDAVTNFKPPAASDDAESEFLNSHSKFEIVDMLRKHTYDDELQQSTRGGRRRLDADTASSGVFDAKAREQLFEKTVTPSDVGKLNRLVIPKQHAEKHFPLSGSGDESSPCVAGASAAKGMLLNFEDVGGKVWRFRYSYWNSSQSYVLTKGWSRFVKEKNLRAGDAVQFFKSTGPDRQLYIDCKARSGEVNNNAGGLFVPIGPVVEPVQMVRLFGVNLLKLPVPGSDGVGKRKEMELFAFECCKKLKVIGAL*