Glyma10g33790 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g33790

Feature Type:	gene_model
Chromosome:	Gm10
Start:	42053073
stop:	42054873
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g33790

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G54010	AT	Annotation by Michelle Graham. TAIR10: UDP-Glycosyltransferase superfamily protein \| chr5:21919819-21921180 REVERSE LENGTH=453	SoyBase	E_val: 5.00E-109	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0016757	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups	SoyBase	N/A	ISS
GO:0016758	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring hexosyl groups	SoyBase	N/A	ISS
KOG1192	KOG	UDP-glucuronosyl and UDP-glucosyl transferase	JGI		ISS
PTHR11926	Panther	GLUCOSYL/GLUCURONOSYL TRANSFERASES	JGI		ISS
PTHR11926:SF77	Panther	GLYCOSYLTRANSFERASE FAMILY PROTEIN	JGI		ISS
PF00201	PFAM	UDP-glucoronosyl and UDP-glucosyl transferase	JGI		ISS
UniRef100_G7I301	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: UDP rhamnose anthocyanidin-3-glucoside rhamnosyltransferase n=1 Tax=Medicago truncatula RepID=G7I301_MEDTR	SoyBase	E_val: 0	ISS
UniRef100_I1LCI8	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LCI8_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma10g33790

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g33790

Paralog	Evidence	Comments
Glyma20g33810	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g33790 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g194000	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g33790

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g33790

Limit To All Plant Sequences

>Glyma10g33790.1   sequence type=CDS   gene model=Glyma10g33790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCCTAGTGAATTAGCTATGAACAATGATGAGCTACATGTGGTTATGTTCCCATTCCTTGCATTTGGCCACATTAGTCCATTTGTTCAGCTCTCCAACAAGTTGTTCTCTCATGGTGTTCATGTCACTTTCTTGTCAGCTGCATCCAACATTCCCAGAATCAGATCAACTCTTAATCTCAATCCAGCCATCAATGTTATCTCACTAAAGTTCCCAAATGGTATAACCAACACTGCTGAATTGCCACCTCACTTAGCTGGAAATCTCATACACGCCCTTGACCTCACTCAAGATCAGGTGAAGTCCCTTTTGTTGGAACTCAAACCCCACTATGTTTTCTTTGACTTTGCACAACATTGGCTCCCAAAATTAGCTTCTGAAGTTGGCATCAAGTCTGTTCATTTCTCAGTCTACTCTGCCATTTCTGATGCTTACATTACCGTGCCTTCTAGATTTGCTGATGTTGAAGGAAGAAACATCACTTTTGAGGATCTTAAAAAGCCTCCACCTGGGTATCCTCAAAACTCTAATATTTCCCTCAAGGCCTTTGAGGCCATGGACTTTATGTTCCTCTTCACAAGATTTGGTGAAAAAAACCTTACTGGTTATGAGCGAGTTTTGCAAAGCCTTGGTGAGTGTTCATTCATAGTGTTCAAAACGTGCAAGGAAATAGAAGGACCCTACTTAGACTACATAGAAACGCAATTTCGAAAACCAGTTTTGCTATCTGGTCCACTAGTCCCCGAGCCATCAACCGATGTGCTTGAGGAAAAGTGGTCCAAATGGTTAGATGGTTTCCCTGCCAAATCTGTCATATTATGCTCCTTTGGCAGTGAGACATTTCTGAGTGATTATCAAATCAAAGAACTAGCCAGTGGGTTAGAACTCACTGGCTTACCTTTCATTTTGGTTCTGAATTTCCCATCCAATCTCTCTGCCAAAGCTGAGTTGGAGAGAGCATTGCCAAAAGGGTATTTGGAAAGAGTGAAGAATAGGGGAGTGGTGCACAGTGGTTGGTTTCAGCAGCAGCTTGTGCTGAAACACTCAAGTGTGGGGTGCTATGTATGCCATGGTGGCTTTAGTTCAGTGATTGAAGCTATGGTCAATGAGTGTCAACTGGTGCTGTTGCCTTTCAAGGGTGACCAGTTTTTCAATTCTAAACTCATTGCCAATGATTTAAAGGCAGGGGTAGAGGTGAATAGGAGTGATGAAGATGGGTTCTTTCACAAAGAGGATATACTGGAGGCATTGAAAACTGTCATGTTGGAGGATAACAAAGAGCAAGGGAAGCAAATAAGAGAAAACCACATGCAATGGAGCAAGTTTTTATCAAATAAGGAAATTCAGAACAAATTCATCACAGATCTGGTTGCCCAGTTAAAGTCTATGGCTTAG

Predicted protein sequences of Glyma10g33790

Limit To All Plant Sequences

>Glyma10g33790.1   sequence type=predicted peptide   gene model=Glyma10g33790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MPSELAMNNDELHVVMFPFLAFGHISPFVQLSNKLFSHGVHVTFLSAASNIPRIRSTLNLNPAINVISLKFPNGITNTAELPPHLAGNLIHALDLTQDQVKSLLLELKPHYVFFDFAQHWLPKLASEVGIKSVHFSVYSAISDAYITVPSRFADVEGRNITFEDLKKPPPGYPQNSNISLKAFEAMDFMFLFTRFGEKNLTGYERVLQSLGECSFIVFKTCKEIEGPYLDYIETQFRKPVLLSGPLVPEPSTDVLEEKWSKWLDGFPAKSVILCSFGSETFLSDYQIKELASGLELTGLPFILVLNFPSNLSAKAELERALPKGYLERVKNRGVVHSGWFQQQLVLKHSSVGCYVCHGGFSSVIEAMVNECQLVLLPFKGDQFFNSKLIANDLKAGVEVNRSDEDGFFHKEDILEALKTVMLEDNKEQGKQIRENHMQWSKFLSNKEIQNKFITDLVAQLKSMA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain