SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g33760

Feature Type:gene_model
Chromosome:Gm10
Start:42035643
stop:42037088
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g33760
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G25140AT Annotation by Michelle Graham. TAIR10: oleosin 1 | chr4:12900498-12901259 FORWARD LENGTH=173 SoyBaseE_val: 2.00E-43ISS
GO:0006406GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA export from nucleus SoyBaseN/AISS
GO:0006606GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into nucleus SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010344GO-bp Annotation by Michelle Graham. GO Biological Process: seed oilbody biogenesis SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF01277PFAM Oleosin JGI ISS
UniRef100_C6SZ13UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SZ13_SOYBN SoyBaseE_val: 4.00E-100ISS
UniRef100_G7I2Z9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Oleosin n=1 Tax=Medicago truncatula RepID=G7I2Z9_MEDTR SoyBaseE_val: 4.00E-65ISS

Expression Patterns of Glyma10g33760
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g33760
ParalogEvidenceComments
Glyma20g33850 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g33760 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g193900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g33760
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g33760
>Glyma10g33760.1   sequence type=CDS   gene model=Glyma10g33760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGAGCTTCACTACCAACCACAACACCAATACCCCCTCCGCTACCCTAACGATCCACACCAACAAACCCGTTCCTCCACCCACCAGGTCGTCAAGGCCGCCACCGCCGTCACAGCGGGCGGCTCCCTCTTGATCCTCGCCTCGTTGATCCTCGCCGCCACCGTCATTGCCCTCACCATCGTCACCCCGCTGTTCGTCATTTTCAGTCCGGTTCTCGTCCCCGCCGTAATCACCGTTGCGCTCCTGAGCCTGGGGTTCCTCGCCTCGAGTGGGTTCGGTGTGGCGGCGATCACGGTGCTGGCGTGGATCTACAGGTACGTCACCGGCAAGCAACCACCTGGCGCGGATCAGTTAGACAGCGCGCGTCACAAGATCATGGACAAGGCGCGTGAGATCAAGGACTACGGACAGCAACAAATCAGCGGGGTCCAGGCTTCTTAA
Predicted protein sequences of Glyma10g33760
>Glyma10g33760.1   sequence type=predicted peptide   gene model=Glyma10g33760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAELHYQPQHQYPLRYPNDPHQQTRSSTHQVVKAATAVTAGGSLLILASLILAATVIALTIVTPLFVIFSPVLVPAVITVALLSLGFLASSGFGVAAITVLAWIYRYVTGKQPPGADQLDSARHKIMDKAREIKDYGQQQISGVQAS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo