Glyma10g32000 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g32000

Feature Type:	gene_model
Chromosome:	Gm10
Start:	40472087
stop:	40473253
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g32000

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G10250	AT	Annotation by Michelle Graham. TAIR10: HSP20-like chaperones superfamily protein \| chr4:6370537-6371124 FORWARD LENGTH=195	SoyBase	E_val: 2.00E-84	ISS
GO:0006457	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein folding	SoyBase	N/A	ISS
GO:0009408	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to heat	SoyBase	N/A	ISS
GO:0009644	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to high light intensity	SoyBase	N/A	ISS
GO:0042542	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to hydrogen peroxide	SoyBase	N/A	ISS
GO:0005783	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
KOG0710	KOG	Molecular chaperone (small heat-shock protein Hsp26/Hsp42)	JGI		ISS
PTHR11527	Panther	SMALL HEAT-SHOCK PROTEIN (HSP20) FAMILY	JGI		ISS
PTHR11527:SF14	Panther	LETHAL(2) ESSENTIAL FOR LIFE - RELATED	JGI		ISS
PF00011	PFAM	Hsp20/alpha crystallin family	JGI		ISS
UniRef100_I1LC12	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LC12_SOYBN	SoyBase	E_val: 3.00E-137	ISS
UniRef100_P30236	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 22.0 kDa class IV heat shock protein n=1 Tax=Glycine max RepID=HSP41_SOYBN	SoyBase	E_val: 1.00E-109	ISS

Expression Patterns of Glyma10g32000

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g32000

Paralog	Evidence	Comments
Glyma20g35650	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g32000 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g176400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g32000

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g32000

Limit To All Plant Sequences

>Glyma10g32000.1   sequence type=CDS   gene model=Glyma10g32000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGCTGCCACAACTAAACTTGTTCTTAGTGTCATTTTTGTTGCTCTTTGTTGCCAGAGCAAATGGTTCTCTGCTCCCATTCATAGATCCTCCCACCACTCTCTTGGCTGATCTCTGGTCCGATCGCTTCCCGGACCCGTTTCGAGTGCTGGAACAGATTCCATTTGGTGTTGACAAAGATGAACCCTCCATGGCTATGTCACCTGCTAGAGTGGACTGGAAGGAGACACCAGAGGGGCATGTTATAATGCTGGACGTGCCGGGGCTGAAGAGAGAAGAGATAAAGATAGAGGTGGAGGAGAATAGGGTGCTGAGAGTGAGTGGTGAGAGGAAGAAGGAAGAGGAGAAGAAAGGGGATCACTGGCATAGAGTGGAGAGGTCCTATGGCAAGTTCTGGAGGCAGTTCAGGTTGCCACAAAATGTGGACTTGGATTCTGTTAAGGCTAAGATGGAGAATGGGGTGCTCACTTTGACACTTGACAAGTTGTCACCTGATAAGATCAAAGGTCCCAGGTTGGTCAGCATTGCTGGAGAGGATCAGCAACAAGGTAACCTCAACAGTGATGGGGTCAAGCAGGAGCTTTGA

Predicted protein sequences of Glyma10g32000

Limit To All Plant Sequences

>Glyma10g32000.1   sequence type=predicted peptide   gene model=Glyma10g32000   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRLPQLNLFLVSFLLLFVARANGSLLPFIDPPTTLLADLWSDRFPDPFRVLEQIPFGVDKDEPSMAMSPARVDWKETPEGHVIMLDVPGLKREEIKIEVEENRVLRVSGERKKEEEKKGDHWHRVERSYGKFWRQFRLPQNVDLDSVKAKMENGVLTLTLDKLSPDKIKGPRLVSIAGEDQQQGNLNSDGVKQEL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain