SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g29580): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g29580): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g29580

Feature Type:gene_model
Chromosome:Gm10
Start:38412623
stop:38420061
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g29580
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G27540AT Annotation by Michelle Graham. TAIR10: MIRO-related GTP-ase 1 | chr5:9722816-9727112 FORWARD LENGTH=648 SoyBaseE_val: 0ISS
GO:0000003GO-bp Annotation by Michelle Graham. GO Biological Process: reproduction SoyBaseN/AISS
GO:0000741GO-bp Annotation by Michelle Graham. GO Biological Process: karyogamy SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006325GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin organization SoyBaseN/AISS
GO:0006626GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to mitochondrion SoyBaseN/AISS
GO:0007005GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrion organization SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0007264GO-bp Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009860GO-bp Annotation by Michelle Graham. GO Biological Process: pollen tube growth SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010638GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of organelle organization SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019725GO-bp Annotation by Michelle Graham. GO Biological Process: cellular homeostasis SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0030048GO-bp Annotation by Michelle Graham. GO Biological Process: actin filament-based movement SoyBaseN/AISS
GO:0033044GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chromosome organization SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0051604GO-bp Annotation by Michelle Graham. GO Biological Process: protein maturation SoyBaseN/AISS
GO:0051645GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi localization SoyBaseN/AISS
GO:0051646GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrion localization SoyBaseN/AISS
GO:0060151GO-bp Annotation by Michelle Graham. GO Biological Process: peroxisome localization SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0005509GO-mf Annotation by Michelle Graham. GO Molecular Function: calcium ion binding SoyBaseN/AISS
GO:0005525GO-mf Annotation by Michelle Graham. GO Molecular Function: GTP binding SoyBaseN/AISS
KOG1707 KOG Predicted Ras related/Rac-GTP binding protein JGI ISS
PTHR24072Panther FAMILY NOT NAMED JGI ISS
PTHR24072:SF12Panther SUBFAMILY NOT NAMED JGI ISS
PF08355PFAM EF hand associated JGI ISS
PF08356PFAM EF hand associated JGI ISS
PF08477PFAM Miro-like protein JGI ISS
UniRef100_I1LBC8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mitochondrial Rho GTPase n=1 Tax=Glycine max RepID=I1LBC8_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1LBC8UniRef Annotation by Michelle Graham. Best UniRef hit: Mitochondrial Rho GTPase n=1 Tax=Glycine max RepID=I1LBC8_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g29580
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g29580 not represented in the dataset
Glyma10g29580 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g29580
ParalogEvidenceComments
Glyma20g37730 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g29580 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g154700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g29580
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g29580
>Glyma10g29580.1   sequence type=CDS   gene model=Glyma10g29580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAAAGCTACTTCCGGAACCGTCAATCCTCACAGCCGTACCGGAGTTCGGATTGTCGTCGCCGGAGACCAGGGCACCGGAAAATCTAGCCTCATCATCACGGCCGCCGCCGAAAACTTTCCGGTGAATGTACCACCGGTGTTGCCTCCCACGCGGTTGCCTGAAGATCTGTATCCGGATCGCGTGCCTATCACCATCATCGACACCTCTTCCCGTGCTGAGGATAGTGATAAAGTTGCTGAAGAATTGCAGAGGGCTGACACAGTTGTCCTTACCTATGCATGTGATCGGCCTGAGACACTTGAAAATCTTAGTATATTTTGGCTTCCACATCTTCGCAAACTAGAGGTGAAAGTTCCAGTTATAGTAGTTGGTTGTAAGCTTGATTTGAGAGATGAGAATCAGCAGGTGAGCCTAGAACAGGTGATGTCACCAATAATGCAACAGTTCCGAGAGATTGAAACTTGCATTGAGTGTTCAGCATCTAGGCATATTCAGGTCCCCGAAGTTTTCTACTATGCACAGAAGGCCGTGCTTCATCCAACAGCTCCATTATTTGATCAAGAGTCACAAACTCTAAAGCCTCGATGCGTGCGAGCCTTGAAGCGGATTTTTATCCTTTGTGATCATGACAGAGATGGTGCCCTTAGTGATGCTGAGCTGAATGACTTTCAGGTTAAATGTTTCAATGCTCCTTTGCAACCATCTGAAATTGTGGGTGTAAAGAAGGTTGTACAAGAAAAATTGTCTGAAGGGGTGAATGAACGTGGACTTACTTTGACTGGATTCTTATTTCTTCATGCCCTTTTCATAGAAAAAGGGCGTCTTGAGACAACATGGACTGTGCTCAGGAAGTTTGGATATAATGATGATATCAAGCTTGCTGATGATCTAATTCCACCTATAAAACGTGCTCCTGATCAGAGTGTGGAGCTGACAAATGAAGCAATTGAGTTTTTGAGGGCAATTTTTGATGCGTTTGATAGTGATGGGGATGGGATGTTGAGACCTCGTGAAATCGAAGAATTATTTTCTACTGCCCCGGAAAGTCCTTGGACTGGAATTCCATATGAGGACGCTGCAGAAAAAAATGCATTTGGAGGACTATCACTAGAAGCGTTTTTGTCAGAGTGGGCACTTATGACACTTCTAAACCCAACTTTTAGTGTGGAGAATCTGATATACATTGGTTATCCTGGTGATCCATCATCTGCTATTCGTGTGACTAGGAGGCGACGCATGGATCGCAAGAAGCAGCATTCAGACAGAAATGTTTTGCAGTGCTTTGTTTTTGGGCCTAGGAAGGCTGGAAAATCTGCATTATTGAATTCTTTTATTGGAAGGCCATATTCTGAAAGTTACAATCCAACCACTGAAGATCATTATGCTGTAAATGTAGTTGATATTTCTATGGAAAACAAAAAATATCTTGTTCTGAGAGAGATTCCTGAAGATGGAGTGAGGAAGCTCCTGTCCAATAAGGAGTCTTTGGCCTCATGTGACATTGCAGTTTTTGTTCATGACAGGTCTGATGAATCCTCATGGAGAACATCGTCTGAACTGTTGGTTGAAATTGCTAGCCATGGAGAAGATACTGGCTTTGAGGTGCCCTGCCTGATAGTTGCAGCTAAAGATGATCTGGATTCATTTCCAATGGCTATACAGGAGTCAACTAGGGTTAGCCAAGATATGGGAGTAGAGGCTCCTATACCCATCAGTGTGAAGTTAGGAGATTTCAACAGTCTTTTTCGTAAAATTGTAACGGCTGCTGATCATCCTCATTTAAGCATTCCAGAAACTGAAGCTGGAAGAAGCCGCAAGCAGTACCACAGGCTTATTAATCGATCTCTTATGGCTGTTTCAGTTGGAGCTGCGGTGGTCGTAGTTGGGCTGGCAGCTTATAGGGTATATGCTGCAAGGAAGAATGCGTCTGGTTAA
Predicted protein sequences of Glyma10g29580
>Glyma10g29580.1   sequence type=predicted peptide   gene model=Glyma10g29580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAKATSGTVNPHSRTGVRIVVAGDQGTGKSSLIITAAAENFPVNVPPVLPPTRLPEDLYPDRVPITIIDTSSRAEDSDKVAEELQRADTVVLTYACDRPETLENLSIFWLPHLRKLEVKVPVIVVGCKLDLRDENQQVSLEQVMSPIMQQFREIETCIECSASRHIQVPEVFYYAQKAVLHPTAPLFDQESQTLKPRCVRALKRIFILCDHDRDGALSDAELNDFQVKCFNAPLQPSEIVGVKKVVQEKLSEGVNERGLTLTGFLFLHALFIEKGRLETTWTVLRKFGYNDDIKLADDLIPPIKRAPDQSVELTNEAIEFLRAIFDAFDSDGDGMLRPREIEELFSTAPESPWTGIPYEDAAEKNAFGGLSLEAFLSEWALMTLLNPTFSVENLIYIGYPGDPSSAIRVTRRRRMDRKKQHSDRNVLQCFVFGPRKAGKSALLNSFIGRPYSESYNPTTEDHYAVNVVDISMENKKYLVLREIPEDGVRKLLSNKESLASCDIAVFVHDRSDESSWRTSSELLVEIASHGEDTGFEVPCLIVAAKDDLDSFPMAIQESTRVSQDMGVEAPIPISVKLGDFNSLFRKIVTAADHPHLSIPETEAGRSRKQYHRLINRSLMAVSVGAAVVVVGLAAYRVYAARKNASG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo