SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g27870

Feature Type:gene_model
Chromosome:Gm10
Start:36681311
stop:36683256
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g27870
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G02360AT Annotation by Michelle Graham. TAIR10: Chitinase family protein | chr1:472138-473116 REVERSE LENGTH=272 SoyBaseE_val: 2.00E-124ISS
GO:0002679GO-bp Annotation by Michelle Graham. GO Biological Process: respiratory burst involved in defense response SoyBaseN/AISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006865GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid transport SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0016998GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall macromolecule catabolic process SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0004568GO-mf Annotation by Michelle Graham. GO Molecular Function: chitinase activity SoyBaseN/AISS
KOG4742 KOG Predicted chitinase JGI ISS
PTHR22595Panther CHITINASE-RELATED JGI ISS
PTHR22595:SF11Panther CLASS I CHITINASE JGI ISS
PF00182PFAM Chitinase class I JGI ISS
UniRef100_B9RN36UniRef Annotation by Michelle Graham. Most informative UniRef hit: Class I chitinase, putative n=1 Tax=Ricinus communis RepID=B9RN36_RICCO SoyBaseE_val: 2.00E-135ISS
UniRef100_UPI000233CC2DUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233CC2D related cluster n=1 Tax=unknown RepID=UPI000233CC2D SoyBaseE_val: 1.00E-156ISS

Expression Patterns of Glyma10g27870
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g27870 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g138400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g27870
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g27870
>Glyma10g27870.2   sequence type=CDS   gene model=Glyma10g27870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGTTGGTCCATCCAATGCAGCATATAGGTGGCAAATTGATCAAAGGGGGTTTCTTTTAGAAATTTATTCCCAAAAGTGCAAAGAGCTTTTTGACTCCATTTTCATCCACAAAGATAACAATGCATGCCCTGCCAGAAACTTCTACACCTACGACTCCTTCATCAATGCATCCAAACGCTTCCCTAGATTTGGCACCACTGGTAGTCCAACCACGCGCAAGCGTGAGATTGCAGCCTTTCTTGCTCAGATTTCACATGAAACCACAGGTGGGTGGGCCACAGCACCTGATGGACCCTATGCTTGGGGATTGTGCTTCAAGGAAGAAATTAGCCCTCAATGTCACTATTGTGATTCCACCAACACTCAATGGCCTTGTTATCCTGGACAAAGTTACAAAGGCAGAGGGCCAATTCAACTTTCATGGAACTACAACTATGGACCAGCAGGGAAGGCTTTGGGATTTGATGGATTGAGAAACCCAGATGTGCAAAAGCCAAAACCTTCTTGCCACAATGTGATGGTTGGAAAATATGTGCCAACACAAGCTGACATAGCAGCTAATCGAACTGCAGGGTATGGCTTTGTGACTAACATAATCAATGGTGGACTTGAATGTGGAATTCCTGATGATTCAAGGGTGAATGATAGGATTGGATACTTTCAAAGATATGCAACCATGTTTAACGTAGATACAGGACCTAACTTGGACTGTGCAAATCAGAAGTCTTTCTAA
Predicted protein sequences of Glyma10g27870
>Glyma10g27870.2   sequence type=predicted peptide   gene model=Glyma10g27870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKVGPSNAAYRWQIDQRGFLLEIYSQKCKELFDSIFIHKDNNACPARNFYTYDSFINASKRFPRFGTTGSPTTRKREIAAFLAQISHETTGGWATAPDGPYAWGLCFKEEISPQCHYCDSTNTQWPCYPGQSYKGRGPIQLSWNYNYGPAGKALGFDGLRNPDVQKPKPSCHNVMVGKYVPTQADIAANRTAGYGFVTNIINGGLECGIPDDSRVNDRIGYFQRYATMFNVDTGPNLDCANQKSF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo