SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g27660): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g27660): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g27660

Feature Type:gene_model
Chromosome:Gm10
Start:36410162
stop:36413011
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g27660
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G35830AT Annotation by Michelle Graham. TAIR10: aconitase 1 | chr4:16973007-16977278 REVERSE LENGTH=795 SoyBaseE_val: 2.00E-134ISS
GO:0000302GO-bp Annotation by Michelle Graham. GO Biological Process: response to reactive oxygen species SoyBaseN/AISS
GO:0006007GO-bp Annotation by Michelle Graham. GO Biological Process: glucose catabolic process SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006101GO-bp Annotation by Michelle Graham. GO Biological Process: citrate metabolic process SoyBaseN/AISS
GO:0006102GO-bp Annotation by Michelle Graham. GO Biological Process: isocitrate metabolic process SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007033GO-bp Annotation by Michelle Graham. GO Biological Process: vacuole organization SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0010039GO-bp Annotation by Michelle Graham. GO Biological Process: response to iron ion SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0055072GO-bp Annotation by Michelle Graham. GO Biological Process: iron ion homeostasis SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0003994GO-mf Annotation by Michelle Graham. GO Molecular Function: aconitate hydratase activity SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
GO:0048027GO-mf Annotation by Michelle Graham. GO Molecular Function: mRNA 5'-UTR binding SoyBaseN/AISS
GO:0051539GO-mf Annotation by Michelle Graham. GO Molecular Function: 4 iron, 4 sulfur cluster binding SoyBaseN/AISS
PTHR11670Panther ACONITASE JGI ISS
PTHR11670:SF1Panther 3-ISOPROPYLMALATE DEHYDRATASE SUBUNIT JGI ISS
PF00330PFAM Aconitase family (aconitate hydratase) JGI ISS
UniRef100_B9SXB6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Aconitase, putative n=1 Tax=Ricinus communis RepID=B9SXB6_RICCO SoyBaseE_val: 3.00E-136ISS
UniRef100_I1LI49UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LI49_SOYBN SoyBaseE_val: 2.00E-143ISS

Expression Patterns of Glyma10g27660
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g27660 not represented in the dataset
Glyma10g27660 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g27660 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma10g27660
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g27660
>Glyma10g27660.1   sequence type=CDS   gene model=Glyma10g27660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GTTAATTTAGAATACCTTGGTAGAGTTGTGTTCAACATAAATGGTGTGCTTTATCCTGACAGCGTTGTTGGAACTGATTCACACATAACTATGATTGATGGCCTGGGTGTTGCTAGATGGGGAGTTGGTGGAATAGAAGCAGAAGCTGCAATGCTTGGCCAGCCCATGAGCATGGTCCTACCTGGTGTCGTTGGGTTCAAACTATTATGCAAACTACGAGATGGTGTCACAGCTACTAACTTGGTGTTGACTGTTACACAAATGCTAAGAAAGCATGGGGTTGTTGGCAAGTTTGTAGAGTTTTATGGGGAAGGCATGAGTGAACTGTCTTTGGCAGATCGTGCCACCATAGCAAACATGTCTCCTGAATACATCACTGAGTATGGTGCAACCATGCGCTTCTTTGTTGTGGATCATGTCACTTTCCAATATTTGAGACTAATTTCTAGAAGTGATGAGACTGTAAAATCCTACTTACGAGCAAATAAGATGTTTGTGGATTACAACGAGACAATGTACTCATCGTATTTGGAACTCAATCTTCAGGATGTAGAACCTTGTGTCTCAAGTCCTAAAAGTGTGCATGTTTTGGCCCCTTACTTCATGGGGATCTGTGACCAGGAAGATTTTACTGTACCAAAAGAATCTCAGAATAAGGTTGCAGCATTCACATTCCAAGGGACACCAGCACATCTTAGGCACGGTGATGTTGTTATAGCTGCTATCATCACCAGTTGTACAAATACTTCAAATCCTAGCGTAATGCTTGGAGTTGCATTGGTTGCAAAGAAAGCATGTGAATTTGAGGGCCGAATTCACCCATTAACAAGATCTAATTATCTTTCTTCTCCTCCTCTTGTTGTTGTCTATGCTCTTGCTGGCACA
Predicted protein sequences of Glyma10g27660
>Glyma10g27660.1   sequence type=predicted peptide   gene model=Glyma10g27660   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
VNLEYLGRVVFNINGVLYPDSVVGTDSHITMIDGLGVARWGVGGIEAEAAMLGQPMSMVLPGVVGFKLLCKLRDGVTATNLVLTVTQMLRKHGVVGKFVEFYGEGMSELSLADRATIANMSPEYITEYGATMRFFVVDHVTFQYLRLISRSDETVKSYLRANKMFVDYNETMYSSYLELNLQDVEPCVSSPKSVHVLAPYFMGICDQEDFTVPKESQNKVAAFTFQGTPAHLRHGDVVIAAIITSCTNTSNPSVMLGVALVAKKACEFEGRIHPLTRSNYLSSPPLVVVYALAGT






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo