Glyma10g27640 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g27640

Feature Type:	gene_model
Chromosome:	Gm10
Start:	36339062
stop:	36343831
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g27640

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G33390	AT	Annotation by Michelle Graham. TAIR10: unknown protein; Has 34 Blast hits to 34 proteins in 10 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 34; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). \| chr2:14151714-14152698 FORWARD LENGTH=98	SoyBase	E_val: 1.00E-23	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
UniRef100_UPI000233C643	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233C643 related cluster n=1 Tax=unknown RepID=UPI000233C643	SoyBase	E_val: 6.00E-64	ISS

Expression Patterns of Glyma10g27640

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g27640

Paralog	Evidence	Comments
Glyma20g21600	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g27640 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g136600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g27640

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g27640

Limit To All Plant Sequences

>Glyma10g27640.2   sequence type=CDS   gene model=Glyma10g27640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATTCTAAGGATATTAATGGTTGCCTCATGGATAAACATAAACCTGTGGTGACATCTTCTTTGGTTTGTGAAAAGGTTGAAGATCATGTCAACGGAGAAGATGATAGTGATTCCAATTCTTTGTTGCCTCCTCGGAGAGGTGGCATGTCCAGAAACTGTGAAAAGACTCGCCGGAAAGTGCAGTGGAATGATAGGAATGGAAACAAGCTTGCTGAGGTGTTGGAATATGAGCCAAGTGATGTCAGTGATTCAGAAGATGAGGATTCAGATTCTTGCATCTGTGCAATAATGTAG

Predicted protein sequences of Glyma10g27640

Limit To All Plant Sequences

>Glyma10g27640.2   sequence type=predicted peptide   gene model=Glyma10g27640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDSKDINGCLMDKHKPVVTSSLVCEKVEDHVNGEDDSDSNSLLPPRRGGMSRNCEKTRRKVQWNDRNGNKLAEVLEYEPSDVSDSEDEDSDSCICAIM*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain