SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g27010): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g27010): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g27010

Feature Type:gene_model
Chromosome:Gm10
Start:35547834
stop:35549165
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g27010
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G04400AT Annotation by Michelle Graham. TAIR10: Ribosomal protein L14p/L23e family protein | chr3:1167339-1168308 FORWARD LENGTH=140 SoyBaseE_val: 1.00E-17ISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0022625GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic large ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
PTHR11761Panther 50S RIBOSOMAL PROTEIN L14-RELATED JGI ISS
UniRef100_I1LAQ9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LAQ9_SOYBN SoyBaseE_val: 4.00E-93ISS
UniRef100_Q07760UniRef Annotation by Michelle Graham. Most informative UniRef hit: 60S ribosomal protein L23 n=1 Tax=Nicotiana tabacum RepID=RL23_TOBAC SoyBaseE_val: 7.00E-16ISS

Expression Patterns of Glyma10g27010
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g27010 not represented in the dataset
Glyma10g27010 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g27010 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma10g27010
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g27010
>Glyma10g27010.1   sequence type=CDS   gene model=Glyma10g27010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGAAGCGAGGGAGTGGTGGTTCTGCTGGTAACAAGTTCAGGATGTCACTGGGTTTGCCAGTGGCAGCTGTGTTGAACTGTGCTGACAACACATATCGGGGAAGCCTGATCTTTAGGAAGAAGGTATTGCCAGCCGTTGTTGTGAGACAGCGCAAGCCGTGTGAGAGTTTACAATTCATACTTCTAGTGTTTTTATTTACAAAGGTGTTGTCTCTTACTTTGTTCTGGCAAATGCATTTTCTTCCTGAATTGGGAGGATTGAAATATTGCTGGTTGAGCAGTGCATATCCTATTATTCGTGAGGATGAATTGTGTATGTGTGGAGATTTTGTTTTTGAAGGTTTCTCTGCTTCTCTCAAGACCAGCTACATCATTATGGCCAATCTTACCCTTACTGGG
Predicted protein sequences of Glyma10g27010
>Glyma10g27010.1   sequence type=predicted peptide   gene model=Glyma10g27010   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSKRGSGGSAGNKFRMSLGLPVAAVLNCADNTYRGSLIFRKKVLPAVVVRQRKPCESLQFILLVFLFTKVLSLTLFWQMHFLPELGGLKYCWLSSAYPIIREDELCMCGDFVFEGFSASLKTSYIIMANLTLTG






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo