SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g26690

Feature Type:gene_model
Chromosome:Gm10
Start:35136748
stop:35139150
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g26690
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G13510AT Annotation by Michelle Graham. TAIR10: ammonium transporter 1;1 | chr4:7858220-7859725 FORWARD LENGTH=501 SoyBaseE_val: 0ISS
GO:0001666GO-bp Annotation by Michelle Graham. GO Biological Process: response to hypoxia SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006820GO-bp Annotation by Michelle Graham. GO Biological Process: anion transport SoyBaseN/AISS
GO:0006862GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide transport SoyBaseN/AISS
GO:0006888GO-bp Annotation by Michelle Graham. GO Biological Process: ER to Golgi vesicle-mediated transport SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010311GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root formation SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0015695GO-bp Annotation by Michelle Graham. GO Biological Process: organic cation transport SoyBaseN/AISS
GO:0015696GO-bp Annotation by Michelle Graham. GO Biological Process: ammonium transport SoyBaseN/AISS
GO:0015802GO-bp Annotation by Michelle Graham. GO Biological Process: basic amino acid transport SoyBaseN/AISS
GO:0031347GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of defense response SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043090GO-bp Annotation by Michelle Graham. GO Biological Process: amino acid import SoyBaseN/AISS
GO:0043269GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of ion transport SoyBaseN/AISS
GO:0051258GO-bp Annotation by Michelle Graham. GO Biological Process: protein polymerization SoyBaseN/AISS
GO:0080167GO-bp Annotation by Michelle Graham. GO Biological Process: response to karrikin SoyBaseN/AISS
GO:0080181GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root branching SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0008519GO-mf Annotation by Michelle Graham. GO Molecular Function: ammonium transmembrane transporter activity SoyBaseN/AISS
KOG0682 KOG Ammonia permease JGI ISS
PTHR11730Panther AMMONIUM TRANSPORTER JGI ISS
PTHR11730:SF8Panther AMMONIUM TRANSPORTER 1 JGI ISS
PF00909PFAM Ammonium Transporter Family JGI ISS
UniRef100_E2CWJ2UniRef Annotation by Michelle Graham. Most informative UniRef hit: AMT1;1 ammonium/proton co-transporter n=1 Tax=Phaseolus vulgaris RepID=E2CWJ2_PHAVU SoyBaseE_val: 0ISS
UniRef100_UPI0001E7A3E6UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001E7A3E6 related cluster n=1 Tax=unknown RepID=UPI0001E7A3E6 SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g26690
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g26690
ParalogEvidenceComments
Glyma20g21030 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g26690 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g132300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g26690
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g26690
>Glyma10g26690.1   sequence type=CDS   gene model=Glyma10g26690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCGCTGCCTGCTTGTCCCGCCGAACAACTGGCCCAACTTCTCGGCCCAAACACCACAGACGCCTCCGCCGCCGCCTCCCTTATCTGCGGCCAGTTCGCCGCCGTGGACAGCAAGTTCGTCGACACGGCCTTCGCCGTCGACAACACCTACCTCCTCTTTTCCGCCTACCTCGTTTTTTCTATGCAGCTCGGCTTCGCCATGCTCTGCGCCGGCTCCGTCCGCGCCAAGAACACCATGAACATCATGCTCACCAACGTCCTGGACGCTGCCGCCGGCGGCCTCTTCTACTACCTCTTCGGCTTCGCCTTCGCTTTCGGCTCCCCCTCCAACGGCTTCATCGGTAAACATTTCTTCGGCCTCAAGGACATCCCTTCATCCTCCTACGACTACAGCTACTTCCTCTACCAATGGGCCTTCGCCATCGCCGCCGCCGGCATCACCAGCGGAAGCATCGCCGAACGCACACAGTTCGTGGCCTATCTCATCTACTCCTCCTTCCTCACCGGCTTCGTCTATCCGGTGGTCTCCCACTGGTTCTGGTCCCCAGACGGCTGGGCCTCTGCCTTTAAGATCACCGACCGGCTATTTTCCACCGGCGTAATAGACTTCGCCGGTTCCGGCGTAGTCCACATGGTCGGCGGAATAGCCGGCCTATGGGGAGCGCTGATCGAAGGCCCAAGAATGGGACGTTTCGATCATGCAGGACGAGCTGTGGCCTTGCGAGGCCACAGCGCGTCCTTAGTAGTCCTGGGAACCTTCTTGCTTTGGTTCGGTTGGTACGGATTTAACCCCGGTTCATTTAACAAAATCCTACTTACTTACGGTAACTCAGGAAATTACTACGGTCAATGGAGCGCGGTTGGCAGAACCGCGGTCACCACTACCCTAGCGGGGTCAACAGCTGCCTTGACCACGCTATTCGGTAAACGGGTGATATCCGGTCACTGGAACGTGACCGATGTCTGCAACGGGCTGTTAGGCGGTTTCGCGGCGATAACAGCCGGTTGCTCCGTGGTTGAGCCATGGGCAGCCATCGTATGCGGTTTTGTTGCTTCTATAGTATTAATAGCTTGCAACAAATTAGCAGAGAAGGTTAAGTTCGACGATCCTCTGGAGGCGGCGCAGTTGCACGGTGGGTGTGGCACGTGGGGGGTGATATTCACGGCGTTGTTCGCAAAAAAGGAGTATGTGAAGGAGGTTTACGGGTTGGGGAGGGCGCACGGGTTGCTCATGGGGGGTGGTGGGAAGTTGCTGGCGGCGCACGTGATTCAGATTCTGGTGATTGCTGGGTGGGTTAGTGCGACCATGGGACCCTTGTTTTGGGGGTTGAATAAACTGAAGCTGTTGAGGATTTCTTCAGAGGATGAGCTTGCGGGGATGGACATGACTCGCCATGGAGGCTTTGCTTATGCTTATGAGGATGATGAGACGCACAAGCATGGGATGCAGTTGAGGAGGGTTGGGCCCAACGCGTCTTCCACACCCACCACTGATGAATGA
Predicted protein sequences of Glyma10g26690
>Glyma10g26690.1   sequence type=predicted peptide   gene model=Glyma10g26690   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSLPACPAEQLAQLLGPNTTDASAAASLICGQFAAVDSKFVDTAFAVDNTYLLFSAYLVFSMQLGFAMLCAGSVRAKNTMNIMLTNVLDAAAGGLFYYLFGFAFAFGSPSNGFIGKHFFGLKDIPSSSYDYSYFLYQWAFAIAAAGITSGSIAERTQFVAYLIYSSFLTGFVYPVVSHWFWSPDGWASAFKITDRLFSTGVIDFAGSGVVHMVGGIAGLWGALIEGPRMGRFDHAGRAVALRGHSASLVVLGTFLLWFGWYGFNPGSFNKILLTYGNSGNYYGQWSAVGRTAVTTTLAGSTAALTTLFGKRVISGHWNVTDVCNGLLGGFAAITAGCSVVEPWAAIVCGFVASIVLIACNKLAEKVKFDDPLEAAQLHGGCGTWGVIFTALFAKKEYVKEVYGLGRAHGLLMGGGGKLLAAHVIQILVIAGWVSATMGPLFWGLNKLKLLRISSEDELAGMDMTRHGGFAYAYEDDETHKHGMQLRRVGPNASSTPTTDE*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo