SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g26558): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g26558): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g26558

Feature Type:gene_model
Chromosome:Gm10
Start:34936755
stop:34937693
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g26558
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G05642AT Annotation by Michelle Graham. TAIR10: Nucleic acid-binding, OB-fold-like protein | chr2:2098253-2100867 REVERSE LENGTH=532 SoyBaseE_val: 4.00E-11ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF02721PFAM Domain of unknown function DUF223 JGI ISS
UniRef100_G7J1G0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Replication factor-a protein 1 (Rpa1) family protein n=1 Tax=Medicago truncatula RepID=G7J1G0_MEDTR SoyBaseE_val: 2.00E-23ISS
UniRef100_UPI000233957AUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233957A related cluster n=1 Tax=unknown RepID=UPI000233957A SoyBaseE_val: 3.00E-75ISS

Expression Patterns of Glyma10g26558
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g26558 not represented in the dataset
Glyma10g26558 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g26558 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma10g26558
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g26558
>Glyma10g26558.1   sequence type=CDS   gene model=Glyma10g26558   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAGGATTCCTGACAAGATTAGGTCTATTGATGGATCAAAAGAAATGCTTAAGCTTGCTGTTAGGATCACCGATCTTTGGTTCGTTGGGACTCCTAACAAGTCTGAGCAAGCGGAGATGGTTTTTGTTGATTCTGAGGGTGATCAAATTCATGATATTTGTAAATCGGACCACCTCAAGTCTTGGAAAGCTGATTTGAAAGAGAATTGCACTTATGTTATGCATAATTTCAAAGTTGTTAAGAATGATGGTCAATTTAGAGTGTGCGAACATGAGTACAAGTTATTTTTTATTGGAGTGACGGTTGTTAGAGAAGCTGATTTGCATGAACTGTCTTTTAAGGAATTTAGATTTGTTGAATTTTGCAAATGTTGTTGCTGGCAATTTTGTGTCTGGGCTGTTGGTTGTGGTGAAATTTTGTCTTGCACACTTTGGGAGAATTACTGTACTCAGTTCCTATCCTATTTGAATGAACGCGGGGATGATGGGCCGATGGTTATTATATTGACACATGCCAGGATAAAAGATGCACAG
Predicted protein sequences of Glyma10g26558
>Glyma10g26558.1   sequence type=predicted peptide   gene model=Glyma10g26558   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARIPDKIRSIDGSKEMLKLAVRITDLWFVGTPNKSEQAEMVFVDSEGDQIHDICKSDHLKSWKADLKENCTYVMHNFKVVKNDGQFRVCEHEYKLFFIGVTVVREADLHELSFKEFRFVEFCKCCCWQFCVWAVGCGEILSCTLWENYCTQFLSYLNERGDDGPMVIILTHARIKDAQ






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo