SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g24080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g24080): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g24080

Feature Type:gene_model
Chromosome:Gm10
Start:30922304
stop:30924756
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G65680AT Annotation by Michelle Graham. TAIR10: expansin B2 | chr1:24427266-24428399 FORWARD LENGTH=273 SoyBaseE_val: 4.00E-101ISS
GO:0009826GO-bp Annotation by Michelle Graham. GO Biological Process: unidimensional cell growth SoyBaseN/AISS
GO:0009828GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall loosening SoyBaseN/AISS
GO:0009831GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall modification involved in multidimensional cell growth SoyBaseN/AISS
GO:0019953GO-bp Annotation by Michelle Graham. GO Biological Process: sexual reproduction SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
PF01357PFAM Pollen allergen JGI ISS
PF03330PFAM Rare lipoprotein A (RlpA)-like double-psi beta-barrel JGI ISS
UniRef100_D2CNC3UniRef Annotation by Michelle Graham. Most informative UniRef hit: EXPB2 n=1 Tax=Glycine max RepID=D2CNC3_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1LAH2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LAH2_SOYBN SoyBaseE_val: 0ISS

LocusGene SymbolProtein Name
EXPB4 beta-expansin gene 4

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g24080 not represented in the dataset

Glyma10g24080 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g122300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma10g24080.1   sequence type=CDS   gene model=Glyma10g24080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCCTACACTTCAACGTGCACTTTCTCATCTGCTCACTCTTGTAGCTTCACTTTCAATACTCCTAGTGGTACCCTCCTCTTGTTTCAACCCTAAAAAGATTGTGAATGCTTCCTATGCTTCATACTCCTTATATGGTTCAGATTGGTCTCCTGCTGTAGCCACTTGGTATGGACCAGCCCAAGGGGACGGTAGTGAAGGTGGTGCTTGTGGTTATGGAAGTGCTGTTGGGGAACCTCCTTTCTCATCATTGATGTCGGCGGGAAGCCCTCTTTTGTTTGAATCAGGCGAAGGCTGTGGTTCTTGTTACGAGATGAAGTGCACTGGGAATTATGCATGCTCAGGCAATTCTGTAAGGGTAGTCATCACTGATAGCTGTCCTGGGTGTGGTTCAGATGCTCAATATCATTTTGATTTGAGTGGCACTGCTTTTGGTGCGATGGCAATTTCAGGCCAAGACGAGAAGCTACGCAATGCTGGCAAAATAGACATTCAATTTAGAAGAGTTGAATGCAACTATCCCGGTGTATCAATATCTTTTCGCGTGGATCCTGGTTCCAACAAGGAATATTTTGCAATCTTGATTGAATATGAGAGTGGTGATGGTGACCTAGACAAAGTTGAACTCAGGGAAGCACATGCTTCCGCCCAATGGTACTCCATGCAGCGATCATGGGGTGCAGTTTGGAAACTTGACAAAGGGTCAGCACTTGTGGCACCATTCTCCATCAAGCTAACCACTCTCAAATCTGGCAAGACCATTGTGGCTAACAATGTGATCCCTGCTGGGTGGATTATTGATCAGACTTATAGATCAATTGTCAATTTTTAA

>Glyma10g24080.1   sequence type=predicted peptide   gene model=Glyma10g24080   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAPTLQRALSHLLTLVASLSILLVVPSSCFNPKKIVNASYASYSLYGSDWSPAVATWYGPAQGDGSEGGACGYGSAVGEPPFSSLMSAGSPLLFESGEGCGSCYEMKCTGNYACSGNSVRVVITDSCPGCGSDAQYHFDLSGTAFGAMAISGQDEKLRNAGKIDIQFRRVECNYPGVSISFRVDPGSNKEYFAILIEYESGDGDLDKVELREAHASAQWYSMQRSWGAVWKLDKGSALVAPFSIKLTTLKSGKTIVANNVIPAGWIIDQTYRSIVNF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo