SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g20870

Feature Type:gene_model
Chromosome:Gm10
Start:26468404
stop:26469142
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g20870
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G32920AT Annotation by Michelle Graham. TAIR10: glycine-rich protein | chr4:15888153-15896006 REVERSE LENGTH=1432 SoyBaseE_val: 5.00E-62ISS
GO:0006486GO-bp Annotation by Michelle Graham. GO Biological Process: protein glycosylation SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
UniRef100_D7M9M4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycine-rich protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7M9M4_ARALL SoyBaseE_val: 1.00E-59ISS
UniRef100_UPI0002339DD5UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002339DD5 related cluster n=1 Tax=unknown RepID=UPI0002339DD5 SoyBaseE_val: 4.00E-73ISS

Expression Patterns of Glyma10g20870
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g20870 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma10g20870
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g20870
>Glyma10g20870.1   sequence type=CDS   gene model=Glyma10g20870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
GAATACCCAGCTAGGACTTACAAAAATGTTACTGGATCTGATAAATCACTTTGTCACAGTTGTCCTGTCAATGAGCTTCCTCACCGTGCTGCTTATATTTCATATTATTATATTGTGGATGCTATTTGTAAATCTAGCATTCATTTACTTTATTTATTCTTGGGGGTATGTGGTGGTATTACTGAAACCCCTTGTCCCTACCAATGTGTTTTGGACAGATATCATATGCCTGATTATTACACAGCCCTTGAAGAGTTAATTTACAGGTTTGGTGGGCCTTGGCTATTTGGTCTTTTTCTTATGGGTCTCTTGATCTTGTTGGCACTGGTGCTTAGTGTTGCAAGAATGAAATTTGTTGGGGTTGATGAATTACCAGGCCCAGCACCCACCCAACATGGTTCTCAAATAGACCACTCCTTCCTTTTCCTAGGTAGTCATGTTCACAGAATGTACTTTATGGGACCTAATACTTTCAGTGAGCCTTGGCATCTGCCACATACACCTTCAGAGAAAATAAAGGATGTT
Predicted protein sequences of Glyma10g20870
>Glyma10g20870.1   sequence type=predicted peptide   gene model=Glyma10g20870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
EYPARTYKNVTGSDKSLCHSCPVNELPHRAAYISYYYIVDAICKSSIHLLYLFLGVCGGITETPCPYQCVLDRYHMPDYYTALEELIYRFGGPWLFGLFLMGLLILLALVLSVARMKFVGVDELPGPAPTQHGSQIDHSFLFLGSHVHRMYFMGPNTFSEPWHLPHTPSEKIKDV






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo