SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g18310): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g18310): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g18310

Feature Type:gene_model
Chromosome:Gm10
Start:22643160
stop:22648971
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g18310
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G53300AT Annotation by Michelle Graham. TAIR10: ubiquitin-conjugating enzyme 10 | chr5:21632802-21633989 REVERSE LENGTH=148 SoyBaseE_val: 4.00E-101ISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0016881GO-mf Annotation by Michelle Graham. GO Molecular Function: acid-amino acid ligase activity SoyBaseN/AISS
GO:0031625GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin protein ligase binding SoyBaseN/AISS
KOG0417 KOG Ubiquitin-protein ligase JGI ISS
PTHR24068Panther FAMILY NOT NAMED JGI ISS
PF00179PFAM Ubiquitin-conjugating enzyme JGI ISS
UniRef100_C6T2F1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T2F1_SOYBN SoyBaseE_val: 4.00E-105ISS
UniRef100_G7I4J0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ubiquitin carrier protein n=1 Tax=Medicago truncatula RepID=G7I4J0_MEDTR SoyBaseE_val: 1.00E-100ISS

Expression Patterns of Glyma10g18310
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g18310 not represented in the dataset
Glyma10g18310 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g18310 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g096200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g18310
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g18310
>Glyma10g18310.1   sequence type=CDS   gene model=Glyma10g18310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCAAAACGCATTACTAAGGAGTTGAAGGATCTGCAGCAGGACCCTCCTGTTTCCTGCAGTGCTGGCCCTGTTGGTGATGACATGTTTCATTGGCAAGCTACAATTATGGGTCCAACTGACAGTCCTTATGCTGGTGGTGTATTCCTGGTGACCATTCACTTCCCACCAGATTATCCATTTAAGCCACCAAAGGTTTCCTTCCGAACCAAGGTATTTCACCCTAACATAAACAGCAATGGAAGTATCTGTCTGGACATTCTGAAAGAGCAGTGGAGTCCTGCCCTTACAGTTTCCAAGGTGCTACTTTCAATTTGCTCCCTGCTGACAGATCCCAACCCGGATGATCCTTTGGTGCCTGATATTGCTCACATGTACAAGACTGACAGAGACAAGTACGAGAGCACTGCCCGTTCTTGGACTCAGAAATACGCCATGAGCTAG
Predicted protein sequences of Glyma10g18310
>Glyma10g18310.1   sequence type=predicted peptide   gene model=Glyma10g18310   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASKRITKELKDLQQDPPVSCSAGPVGDDMFHWQATIMGPTDSPYAGGVFLVTIHFPPDYPFKPPKVSFRTKVFHPNINSNGSICLDILKEQWSPALTVSKVLLSICSLLTDPNPDDPLVPDIAHMYKTDRDKYESTARSWTQKYAMS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo