SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g16640

Feature Type:gene_model
Chromosome:Gm10
Start:19740061
stop:19740824
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g16640
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G06120AT Annotation by Michelle Graham. TAIR10: ARM repeat superfamily protein | chr5:1845309-1852601 FORWARD LENGTH=1052 SoyBaseE_val: 1.00E-61ISS
GO:0000059GO-bp Annotation by Michelle Graham. GO Biological Process: protein import into nucleus, docking SoyBaseN/AISS
GO:0006486GO-bp Annotation by Michelle Graham. GO Biological Process: protein glycosylation SoyBaseN/AISS
GO:0006886GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular protein transport SoyBaseN/AISS
GO:0009630GO-bp Annotation by Michelle Graham. GO Biological Process: gravitropism SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005643GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear pore SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0008565GO-mf Annotation by Michelle Graham. GO Molecular Function: protein transporter activity SoyBaseN/AISS
PTHR12596Panther EXPORTIN 4,7-RELATED JGI ISS
PTHR12596:SF2Panther EXPORTIN 4 JGI ISS
PF03810PFAM Importin-beta N-terminal domain JGI ISS
UniRef100_B9SHV4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Exportin-7, putative n=1 Tax=Ricinus communis RepID=B9SHV4_RICCO SoyBaseE_val: 6.00E-69ISS
UniRef100_I1LA55UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LA55_SOYBN SoyBaseE_val: 1.00E-99ISS

Expression Patterns of Glyma10g16640
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g16640 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g105100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g16640
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g16640
>Glyma10g16640.1   sequence type=CDS   gene model=Glyma10g16640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGACTTTAGCACAACTGGAAGCAATGTGCGAAAGGCTTTATAACTCGCAGGACTCTGTTGAGAGAGCACATGTGGAAAGCACCCTGAAATGCTTTTCCTTAAACACTGACTACATTTCACAGTGCCAATATGTTCTGGATAATGCATCCTCCCCATATGCATTGATGTTGGCAAGTTCGAGCTTATTGAAGCAAGTGACAGAGCAAAGCCTTCCTTTACAGCTCCGGATTGATATTCGGAACTATCTCATAAACTATCTGGCCAGCAAAGGACCAGAACTGGAGCCCTTTGTGCTTGGATCCTTGATCCAACTCTTTTGTCGCATTACAAAGTTTGGTTGGCTTGATGATGACAAATTCACGGAGGTTGTTAATGAGGCAATGAACTTCTTGAGTCAGGTGACATGTTATGTTTTTATAATGTAG
Predicted protein sequences of Glyma10g16640
>Glyma10g16640.1   sequence type=predicted peptide   gene model=Glyma10g16640   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
METLAQLEAMCERLYNSQDSVERAHVESTLKCFSLNTDYISQCQYVLDNASSPYALMLASSSLLKQVTEQSLPLQLRIDIRNYLINYLASKGPELEPFVLGSLIQLFCRITKFGWLDDDKFTEVVNEAMNFLSQVTCYVFIM*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo