|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT5G06120 | AT | Annotation by Michelle Graham. TAIR10: ARM repeat superfamily protein | chr5:1845309-1852601 FORWARD LENGTH=1052 | SoyBase | E_val: 1.00E-61 | ISS |
| GO:0000059 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein import into nucleus, docking | SoyBase | N/A | ISS |
| GO:0006486 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein glycosylation | SoyBase | N/A | ISS |
| GO:0006886 | GO-bp | Annotation by Michelle Graham. GO Biological Process: intracellular protein transport | SoyBase | N/A | ISS |
| GO:0009630 | GO-bp | Annotation by Michelle Graham. GO Biological Process: gravitropism | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0005643 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nuclear pore | SoyBase | N/A | ISS |
| GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
| GO:0005739 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion | SoyBase | N/A | ISS |
| GO:0008565 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: protein transporter activity | SoyBase | N/A | ISS |
| PTHR12596 | Panther | EXPORTIN 4,7-RELATED | JGI | ISS | |
| PTHR12596:SF2 | Panther | EXPORTIN 4 | JGI | ISS | |
| PF03810 | PFAM | Importin-beta N-terminal domain | JGI | ISS | |
| UniRef100_B9SHV4 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Exportin-7, putative n=1 Tax=Ricinus communis RepID=B9SHV4_RICCO | SoyBase | E_val: 6.00E-69 | ISS |
| UniRef100_I1LA55 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1LA55_SOYBN | SoyBase | E_val: 1.00E-99 | ISS |
|
Glyma10g16640 not represented in the dataset |
Glyma10g16640 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.10g105100 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma10g16640.1 sequence type=CDS gene model=Glyma10g16640 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGAGACTTTAGCACAACTGGAAGCAATGTGCGAAAGGCTTTATAACTCGCAGGACTCTGTTGAGAGAGCACATGTGGAAAGCACCCTGAAATGCTTTTCCTTAAACACTGACTACATTTCACAGTGCCAATATGTTCTGGATAATGCATCCTCCCCATATGCATTGATGTTGGCAAGTTCGAGCTTATTGAAGCAAGTGACAGAGCAAAGCCTTCCTTTACAGCTCCGGATTGATATTCGGAACTATCTCATAAACTATCTGGCCAGCAAAGGACCAGAACTGGAGCCCTTTGTGCTTGGATCCTTGATCCAACTCTTTTGTCGCATTACAAAGTTTGGTTGGCTTGATGATGACAAATTCACGGAGGTTGTTAATGAGGCAATGAACTTCTTGAGTCAGGTGACATGTTATGTTTTTATAATGTAG
>Glyma10g16640.1 sequence type=predicted peptide gene model=Glyma10g16640 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high METLAQLEAMCERLYNSQDSVERAHVESTLKCFSLNTDYISQCQYVLDNASSPYALMLASSSLLKQVTEQSLPLQLRIDIRNYLINYLASKGPELEPFVLGSLIQLFCRITKFGWLDDDKFTEVVNEAMNFLSQVTCYVFIM*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||