Report for Sequence Feature Glyma10g16363
Feature Type: gene_model
Chromosome: Gm10
Start: 19390073
stop: 19392423
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma10g16363
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G41460 AT
Annotation by Michelle Graham. TAIR10: apurinic endonuclease-redox protein | chr2:17285731-17288041 FORWARD LENGTH=403
SoyBase E_val: 3.00E-66 ISS
GO:0000085 GO-bp
Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle
SoyBase N/A ISS
GO:0006281 GO-bp
Annotation by Michelle Graham. GO Biological Process: DNA repair
SoyBase N/A ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0008284 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of cell proliferation
SoyBase N/A ISS
GO:0009640 GO-bp
Annotation by Michelle Graham. GO Biological Process: photomorphogenesis
SoyBase N/A ISS
GO:0016567 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein ubiquitination
SoyBase N/A ISS
GO:0016571 GO-bp
Annotation by Michelle Graham. GO Biological Process: histone methylation
SoyBase N/A ISS
GO:0016579 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein deubiquitination
SoyBase N/A ISS
GO:0043687 GO-bp
Annotation by Michelle Graham. GO Biological Process: post-translational protein modification
SoyBase N/A ISS
GO:0045893 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0048573 GO-bp
Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering
SoyBase N/A ISS
GO:0051276 GO-bp
Annotation by Michelle Graham. GO Biological Process: chromosome organization
SoyBase N/A ISS
GO:0005622 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: intracellular
SoyBase N/A ISS
GO:0042644 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast nucleoid
SoyBase N/A ISS
GO:0003676 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
GO:0003906 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA-(apurinic or apyrimidinic site) lyase activity
SoyBase N/A ISS
GO:0004518 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nuclease activity
SoyBase N/A ISS
GO:0004519 GO-mf
Annotation by Michelle Graham. GO Molecular Function: endonuclease activity
SoyBase N/A ISS
PTHR22748 Panther
AP ENDONUCLEASE
JGI ISS
UniRef100_B9SVS9 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Ap endonuclease, putative n=1 Tax=Ricinus communis RepID=B9SVS9_RICCO
SoyBase E_val: 6.00E-74 ISS
UniRef100_UPI000233C388 UniRef
Annotation by Michelle Graham. Best UniRef hit: UPI000233C388 related cluster n=1 Tax=unknown RepID=UPI000233C388
SoyBase E_val: 0 ISS
Expression Patterns of Glyma10g16363
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma10g16363
Paralog Evidence Comments
Glyma02g34700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma10g16363 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.10g105800 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma10g16363
Coding sequences of Glyma10g16363
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma10g16363.1 sequence type=CDS gene model=Glyma10g16363 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGAATATTTGTCTCCTCTCTTTTAGTATTGTGCCCTTTCTCATTTCTCAGTGCTTTGCAGTGTTTCAGAAGCATTTGAATGCCAAGACATTGGTTTGTCCAACTGTGAAAGCAATGGGGTCTAAAAGACCCTTTTCAAATTCATCAAAACCCTCGTCACCATTTGTTGAGGACAAGAAGAATGTGAAGCTTAAAGGGTTGGAAGCCAGCCTTGGTTCCAAGAAGCTTGTTGTTGAGGAGAATGATGTTAATAGCTATTCGATTGAGCTTGAGAGATTAAGAAATGACCCAACAATAGTAGACACGGTGACTGTTCAGGAACTCCGGAAAACCTTGAAGAGATTTAACGTCCCTGCCAAAGGTCGTAAAGATGATATTTTGTCTGCCTGGAAGAGTTTCGTGGGCAGTAACATGTGTGAACTAGATTCTCATGCACAAGAAAAAAAATGGCCATGGATTTCTTCTGAAAATGCATCTGTAGAAGTGGAGGCTAAAAAAGTATTGGATGAAGACCATATTGAAAATGTCAATGAAAATCCCGAGATATCTGAACTTAACCAGGCTAAGAGAAGGTTAAAACAATCAGAATCTGAGAGAAAAACTATCAAAGTGACAACAAAGAAGAAAGTTTCATTGAAATCAGACGAGGATTCAGCTACTATTCAAACTGAACCATGGACAGTTCTTGCCCACAAGAAGCCTCAAAAAGGTTGGATTGCTTATAATCCTAGAACTATGAGACCCCCACCTCTTGCTCAGGATACAAAATTTGTCAAGCTTTTGTCATGGAATGCCAATGGATTGAGAGCATTGCTAAAATTAGAAGGATTCTCAGCACTTCAACTTGCCCAAAGGGAAGACTTTGATGAGAAGGATATTGAGGAAATCAAACACCATCTAATAGATGGCTATGATAACAGCTTTTGGACATTTAGTGTTTCTAAGCTTGGTTATTCTGGAACAGCAATTATCTCAAGGGTATGTTGA
Predicted protein sequences of Glyma10g16363
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma10g16363.1 sequence type=predicted peptide gene model=Glyma10g16363 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MNICLLSFSIVPFLISQCFAVFQKHLNAKTLVCPTVKAMGSKRPFSNSSKPSSPFVEDKKNVKLKGLEASLGSKKLVVEENDVNSYSIELERLRNDPTIVDTVTVQELRKTLKRFNVPAKGRKDDILSAWKSFVGSNMCELDSHAQEKKWPWISSENASVEVEAKKVLDEDHIENVNENPEISELNQAKRRLKQSESERKTIKVTTKKKVSLKSDEDSATIQTEPWTVLAHKKPQKGWIAYNPRTMRPPPLAQDTKFVKLLSWNANGLRALLKLEGFSALQLAQREDFDEKDIEEIKHHLIDGYDNSFWTFSVSKLGYSGTAIISRVC*