SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g16363

Feature Type:gene_model
Chromosome:Gm10
Start:19390073
stop:19392423
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g16363
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G41460AT Annotation by Michelle Graham. TAIR10: apurinic endonuclease-redox protein | chr2:17285731-17288041 FORWARD LENGTH=403 SoyBaseE_val: 3.00E-66ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0006281GO-bp Annotation by Michelle Graham. GO Biological Process: DNA repair SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0008284GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of cell proliferation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0043687GO-bp Annotation by Michelle Graham. GO Biological Process: post-translational protein modification SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0048573GO-bp Annotation by Michelle Graham. GO Biological Process: photoperiodism, flowering SoyBaseN/AISS
GO:0051276GO-bp Annotation by Michelle Graham. GO Biological Process: chromosome organization SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0042644GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast nucleoid SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003906GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA-(apurinic or apyrimidinic site) lyase activity SoyBaseN/AISS
GO:0004518GO-mf Annotation by Michelle Graham. GO Molecular Function: nuclease activity SoyBaseN/AISS
GO:0004519GO-mf Annotation by Michelle Graham. GO Molecular Function: endonuclease activity SoyBaseN/AISS
PTHR22748Panther AP ENDONUCLEASE JGI ISS
UniRef100_B9SVS9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ap endonuclease, putative n=1 Tax=Ricinus communis RepID=B9SVS9_RICCO SoyBaseE_val: 6.00E-74ISS
UniRef100_UPI000233C388UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C388 related cluster n=1 Tax=unknown RepID=UPI000233C388 SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g16363
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g16363 not represented in the dataset
Glyma10g16363 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g16363
ParalogEvidenceComments
Glyma02g34700 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g16363 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g105800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g16363
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g16363
>Glyma10g16363.1   sequence type=CDS   gene model=Glyma10g16363   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATATTTGTCTCCTCTCTTTTAGTATTGTGCCCTTTCTCATTTCTCAGTGCTTTGCAGTGTTTCAGAAGCATTTGAATGCCAAGACATTGGTTTGTCCAACTGTGAAAGCAATGGGGTCTAAAAGACCCTTTTCAAATTCATCAAAACCCTCGTCACCATTTGTTGAGGACAAGAAGAATGTGAAGCTTAAAGGGTTGGAAGCCAGCCTTGGTTCCAAGAAGCTTGTTGTTGAGGAGAATGATGTTAATAGCTATTCGATTGAGCTTGAGAGATTAAGAAATGACCCAACAATAGTAGACACGGTGACTGTTCAGGAACTCCGGAAAACCTTGAAGAGATTTAACGTCCCTGCCAAAGGTCGTAAAGATGATATTTTGTCTGCCTGGAAGAGTTTCGTGGGCAGTAACATGTGTGAACTAGATTCTCATGCACAAGAAAAAAAATGGCCATGGATTTCTTCTGAAAATGCATCTGTAGAAGTGGAGGCTAAAAAAGTATTGGATGAAGACCATATTGAAAATGTCAATGAAAATCCCGAGATATCTGAACTTAACCAGGCTAAGAGAAGGTTAAAACAATCAGAATCTGAGAGAAAAACTATCAAAGTGACAACAAAGAAGAAAGTTTCATTGAAATCAGACGAGGATTCAGCTACTATTCAAACTGAACCATGGACAGTTCTTGCCCACAAGAAGCCTCAAAAAGGTTGGATTGCTTATAATCCTAGAACTATGAGACCCCCACCTCTTGCTCAGGATACAAAATTTGTCAAGCTTTTGTCATGGAATGCCAATGGATTGAGAGCATTGCTAAAATTAGAAGGATTCTCAGCACTTCAACTTGCCCAAAGGGAAGACTTTGATGAGAAGGATATTGAGGAAATCAAACACCATCTAATAGATGGCTATGATAACAGCTTTTGGACATTTAGTGTTTCTAAGCTTGGTTATTCTGGAACAGCAATTATCTCAAGGGTATGTTGA
Predicted protein sequences of Glyma10g16363
>Glyma10g16363.1   sequence type=predicted peptide   gene model=Glyma10g16363   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNICLLSFSIVPFLISQCFAVFQKHLNAKTLVCPTVKAMGSKRPFSNSSKPSSPFVEDKKNVKLKGLEASLGSKKLVVEENDVNSYSIELERLRNDPTIVDTVTVQELRKTLKRFNVPAKGRKDDILSAWKSFVGSNMCELDSHAQEKKWPWISSENASVEVEAKKVLDEDHIENVNENPEISELNQAKRRLKQSESERKTIKVTTKKKVSLKSDEDSATIQTEPWTVLAHKKPQKGWIAYNPRTMRPPPLAQDTKFVKLLSWNANGLRALLKLEGFSALQLAQREDFDEKDIEEIKHHLIDGYDNSFWTFSVSKLGYSGTAIISRVC*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo