SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g15900

Feature Type:gene_model
Chromosome:Gm10
Start:18621819
stop:18627960
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g15900
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G41540AT Annotation by Michelle Graham. TAIR10: 6-phosphogluconate dehydrogenase family protein | chr2:17326801-17328654 FORWARD LENGTH=462 SoyBaseE_val: 0ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006072GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol-3-phosphate metabolic process SoyBaseN/AISS
GO:0009413GO-bp Annotation by Michelle Graham. GO Biological Process: response to flooding SoyBaseN/AISS
GO:0046168GO-bp Annotation by Michelle Graham. GO Biological Process: glycerol-3-phosphate catabolic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0009331GO-cc Annotation by Michelle Graham. GO Cellular Compartment: glycerol-3-phosphate dehydrogenase complex SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0004367GO-mf Annotation by Michelle Graham. GO Molecular Function: glycerol-3-phosphate dehydrogenase [NAD+] activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016614GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on CH-OH group of donors SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0050662GO-mf Annotation by Michelle Graham. GO Molecular Function: coenzyme binding SoyBaseN/AISS
GO:0051287GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD binding SoyBaseN/AISS
KOG2711 KOG Glycerol-3-phosphate dehydrogenase/dihydroxyacetone 3-phosphate reductase JGI ISS
PTHR11728Panther GLYCEROL-3-PHOSPHATE DEHYDROGENASE JGI ISS
PF01210PFAM NAD-dependent glycerol-3-phosphate dehydrogenase N-terminus JGI ISS
PF07479PFAM NAD-dependent glycerol-3-phosphate dehydrogenase C-terminus JGI ISS
UniRef100_B9T6H7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glycerol-3-phosphate dehydrogenase, putative n=1 Tax=Ricinus communis RepID=B9T6H7_RICCO SoyBaseE_val: 0ISS
UniRef100_I1LA39UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1LA39_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g15900
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g15900 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g107100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g15900
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g15900
>Glyma10g15900.1   sequence type=CDS   gene model=Glyma10g15900   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGTAGTTAGTAATGAGTACTCAAATGGATCTGTTCAAGGCTGCAATAGTTTAGAGGAGAAGCTCGATGATCTTCGTGGCCTACTTGGCAAGGCTGATGGTGATCCTTTGAGAATTGTGAGTGTTGGTGCTGGTGCTTGGGGCAGTGTTTTTGCTGCTTTGCTGCAAGATACTTATGGCCAATTCCGTGATAAGGTGCAAATCAGGATATGGAGAAGGCCAGGAAAGACAGTTGATAGAGCCACTGCAGAGCACCTCTTCGAAGTTATCAATTCTAGGGAGGATGTGTTGAGGAGGTTGATAAGGCGCTGTGCTTATCTGAAATACGTCGAAGCCAGGCTTGGTGATAGGACTCTTCTGGCTGATGAGATTTTGAAAGATGGGTTTTGCTTGAATATGATTGACACACCACTTTGTCCATTGAAGGTGGTCACAAACTTGCAAGAAGCTGTTTGGGATGCTGATATTGTGGTTAATGGTTTGCCTTCAACCGAAACACGCGAGATTTTTGAAGAGATTAGTATATATTGGAAGGAGAGAATCACAGTGCCAGTGATAATCTCTTTGGCAAAGGGTATAGAGGCTGCATTGGAGCCTGTTCCCCATATTATAACCCCCACAAAAATGATTAACCAAGCAACTGGAGTGCCTATGGAGAACATACTTTATCTTGGTGGTCCAAATATTGCCTCAGAAATATACAACAAGGAGTATGCCAATGCTCGAATATGCGGAGCAGAGAAATGGAGGAAACCTCTGGCAAAGTTTCTACGACAACCACATTTTATTGTCTGGGACAACAGTGACCTTGTCACCCATGAGATCATGGGTGGCCTGAAAAATGTCTATGCAATTGGTGCCGGAATGGTAGCAGCCCTTACCAATGAGAGTGCTACTAGCAAATCTGTCTACTTTGCACACTGCACATCAGAGATGATATTTATCACTCATTTGTTGGCTGAAGAGCCTGAGAAACTTGCAGGGCCACTATTGGCTGACACTTATGTGACTTTACTAAAAGGTCGTAACGCATGGTATGGTCAGATGTTAGCTAAGGGTGAATTAAGCCCAGACATGGGTGACAGCATCAGTGGCAAAGGAATGATTCAGGGTGTCTCTGCAGTGGAGGCATTCTTTGAACTTTTGAGCCATTCAAGCCTGAATGTGTTGCACCCAGAAGAAAACAAACCGGTTGCTCCTGTTGAACTCTGCCCCATCCTGAAGACACTGTATAAAATATTGATATCCAGGGAACAGTCATCAGAAGCTATTCTCCAAGCTCTTAGGGATGAAAATCTGAATGATCCCCGTGAACGCATTGAGATTGCACAAAGCCATGCTTTCTACATGCCTTCACTTCTTGGACAACCTTGA
Predicted protein sequences of Glyma10g15900
>Glyma10g15900.1   sequence type=predicted peptide   gene model=Glyma10g15900   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGVVSNEYSNGSVQGCNSLEEKLDDLRGLLGKADGDPLRIVSVGAGAWGSVFAALLQDTYGQFRDKVQIRIWRRPGKTVDRATAEHLFEVINSREDVLRRLIRRCAYLKYVEARLGDRTLLADEILKDGFCLNMIDTPLCPLKVVTNLQEAVWDADIVVNGLPSTETREIFEEISIYWKERITVPVIISLAKGIEAALEPVPHIITPTKMINQATGVPMENILYLGGPNIASEIYNKEYANARICGAEKWRKPLAKFLRQPHFIVWDNSDLVTHEIMGGLKNVYAIGAGMVAALTNESATSKSVYFAHCTSEMIFITHLLAEEPEKLAGPLLADTYVTLLKGRNAWYGQMLAKGELSPDMGDSISGKGMIQGVSAVEAFFELLSHSSLNVLHPEENKPVAPVELCPILKTLYKILISREQSSEAILQALRDENLNDPRERIEIAQSHAFYMPSLLGQP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo