Glyma10g14980 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g14980

Feature Type:	gene_model
Chromosome:	Gm10
Start:	17451993
stop:	17452184
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g14980

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
UniRef100_C6TBN2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Probable aldo-keto reductase 1 n=1 Tax=Glycine max RepID=AKR1_SOYBN	SoyBase	E_val: 4.00E-28	ISS
UniRef100_I1LA15	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1LA15_SOYBN	SoyBase	E_val: 1.00E-38	ISS

Expression Patterns of Glyma10g14980

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g14980 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g109700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g14980

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g14980

Limit To All Plant Sequences

>Glyma10g14980.1   sequence type=CDS   gene model=Glyma10g14980   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ACAACTAAGATTAAGATCCTGAATCAAAACATGGAGGCCTTAACAGTGAAACTGTCGGAAAAGGACCCTAGAGAAATTTCTAAGGCGGTTCCCATTGGTGATGTAGCAGGTGGTAGATACTACAATAGATTGGATCACTTTTCATGGAAGTATGCTAACACACCTCCAAAAGATTCAAAAATCTCAACCTGA

Predicted protein sequences of Glyma10g14980

Limit To All Plant Sequences

>Glyma10g14980.1   sequence type=predicted peptide   gene model=Glyma10g14980   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
TTKIKILNQNMEALTVKLSEKDPREISKAVPIGDVAGGRYYNRLDHFSWKYANTPPKDSKIST*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain