SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma10g14885

Feature Type:gene_model
Chromosome:Gm10
Start:17283412
stop:17285039
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G11240AT Annotation by Michelle Graham. TAIR10: transducin family protein / WD-40 repeat family protein | chr5:3582949-3586782 FORWARD LENGTH=615 SoyBaseE_val: 2.00E-86ISS
GO:0000478GO-bp Annotation by Michelle Graham. GO Biological Process: endonucleolytic cleavage involved in rRNA processing SoyBaseN/AISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0009220GO-bp Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
PTHR22847Panther WD40 REPEAT PROTEIN JGI ISS
PTHR22847:SF201Panther OS03G0300300 PROTEIN JGI ISS
PF00400PFAM WD domain, G-beta repeat JGI ISS
UniRef100_G7JLK9UniRef Annotation by Michelle Graham. Most informative UniRef hit: WD40 repeat-containing protein SMU1 n=1 Tax=Medicago truncatula RepID=G7JLK9_MEDTR SoyBaseE_val: 1.00E-92ISS
UniRef100_UPI000233C223UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233C223 related cluster n=1 Tax=unknown RepID=UPI000233C223 SoyBaseE_val: 2.00E-142ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g14885 not represented in the dataset

Glyma10g14885 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g110200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma10g14885.1   sequence type=CDS   gene model=Glyma10g14885   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCAACGGACGTCAGAGGCATTTTGACAGCTTTCAATCCTTCTCTCGACTTCTTCGCTATCACCACCGGAGACGGTCGCGTCAAGATATGGGACACACTGAAGGGTCAGGTCCACACCGAGTTCGCTGATATCACCTCAACTCATTCAACTGCTACTACCTTACATCATAAATCATCCATTAACGGCCATCTTGCGCTAGATTATACTTGCATCAAGTGGTTCTCCTTCGAAGAAAAGAGGAAAAGGAAGCATATATCCTCCTTGTTGGTGCTTGGAACTGGTGGTGGTGATGTTTTAGCACTTGATGTCGCTTCTGCTCAATTGACTTGGAGACTTACTGACTGTCATCCTGGAGGTGTGAGAGTCATTGCATCTTCAGCAAATGTGTCAAGCATTTATACTGCTGGTGTAGATGGGATGGTATGTGTGATAGATTTCATGACAGGAAACCTGTTGGAGAAATTTAAAGCTTCTACAAAGCCAGTATCCTGCATGTCTGTTTCTCCAGATGGGAACACATTAGCTACTGCAGCAGCACAATTGAAGATTTTTAACTGTTCTAATCACAAAAAGATTCAAAAGTTCTCTGGTCATCCTGGGAGTCTCGTATATTTCCAGATATACATGCATATACTCTATCAGTGCCCTTTTAATTTGTCCTAA

>Glyma10g14885.1   sequence type=predicted peptide   gene model=Glyma10g14885   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASTDVRGILTAFNPSLDFFAITTGDGRVKIWDTLKGQVHTEFADITSTHSTATTLHHKSSINGHLALDYTCIKWFSFEEKRKRKHISSLLVLGTGGGDVLALDVASAQLTWRLTDCHPGGVRVIASSANVSSIYTAGVDGMVCVIDFMTGNLLEKFKASTKPVSCMSVSPDGNTLATAAAQLKIFNCSNHKKIQKFSGHPGSLVYFQIYMHILYQCPFNLS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo