Glyma10g13840 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g13840

Feature Type:	gene_model
Chromosome:	Gm10
Start:	15752004
stop:	15755226
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g13840

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G50480	AT	Annotation by Michelle Graham. TAIR10: 10-formyltetrahydrofolate synthetase \| chr1:18702064-18704687 FORWARD LENGTH=634	SoyBase	E_val: 0	ISS
GO:0009396	GO-bp	Annotation by Michelle Graham. GO Biological Process: folic acid-containing compound biosynthetic process	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0048046	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: apoplast	SoyBase	N/A	ISS
GO:0004329	GO-mf	Annotation by Michelle Graham. GO Molecular Function: formate-tetrahydrofolate ligase activity	SoyBase	N/A	ISS
GO:0005507	GO-mf	Annotation by Michelle Graham. GO Molecular Function: copper ion binding	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
PTHR24508	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24508:SF8	Panther		JGI		ISS
PF01268	PFAM	Formate--tetrahydrofolate ligase	JGI		ISS
UniRef100_Q9SPK5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Formate--tetrahydrofolate ligase n=1 Tax=Arabidopsis thaliana RepID=FTHS_ARATH	SoyBase	E_val: 0	ISS
UniRef100_UPI000233D7CD	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233D7CD related cluster n=1 Tax=unknown RepID=UPI000233D7CD	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma10g13840

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g13840 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g112700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g13840

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g13840

Limit To All Plant Sequences

>Glyma10g13840.1   sequence type=CDS   gene model=Glyma10g13840   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGTTGTGATTGTTGCAATTGCTGCTACACTTGGAAATCTTCTGATGGGATGGGATAGTTCAACTATTGCAGACAAAATGATGTCCTCAACTACAGTGAGGAAGTTGCAGGTGGTGTCCCCTGTTCCTGTGGACATAGACATTGCAAACTCCGTTGAACCCGTTCATATCTCCCAGATTGCCAAAGACCTCAACCTTAGTCCCAATCACTATGACCTTTACGGTAAATACAAGGCCAAGGTTTTGTTGTCGGTTCTTGATGAGCTTCAAGGATCAGAAGATGGGTATTATGTTGTGGTCGGAGGCATTACTCCGACTCCTCTCGGGGAAGGCAAATCTACTACTACAGTGGGGCTCTGTCAAGCTTTAGGTGCTTTTCTTGATAAAAAGGTAGTCACCTGCCTTCGTCAACCATCGCAAGGACCTACTTTTGGAATTAAAGGAGGTGCAGCTGGTGGTGGCTATAGCCAAGTTATTCCCATGGATGAATTCAATCTTCATCTAACAGGAGATATTCATGCAATAACTGCAGCAAACAATCTTCTAGCTGCTGCAATTGATACCCGAATTTTCCATGAGTCAACACAGTCAGATAAGGCTCTTTTTAACCGGTTGTGCCCTCCAAATAAAGAAGGGAAAAGGAGCTTTAGTGATGTCATGTTCAGGCGTCTTACGAAGCTTGGCATTTCAAAGACCAATCCAGATGATCTTACACCAGAAGAAGTAAATAAATTTGCTAGGCTTGATATTGACCCAAATTCTATCACATGGAGGAGAGTAATGGACATCAATGATCGATTCTTGAGAAAAATTGCTATTGGCCAGGGACTTGACGAGAAAGGAATGGTGAGAGAAACAGGCTTTGATATTTCAGTTGCTAGTGAGATTGTGGCTGTTTTGGCACTGACAACATCCTTAGCTGATATGCGAAAGAGGCTTGGGAAAATGGTTATTGGGAATACGCGAGAGAGCCATTTCACATTCTGTTTTATGTTAGATCTCATTACTGAAATGGCTCAAGAAACGACCCGTGCGTTACGCACGGGTTACATCCTAGTATATATATATATATATGGAAGCACCAACATATTTAAGAAAAAGACAATTCTTTTTTGTTTTAATCATTTGAAGCCCATCTTTTATTTTTGTTTACATTAA

Predicted protein sequences of Glyma10g13840

Limit To All Plant Sequences

>Glyma10g13840.1   sequence type=predicted peptide   gene model=Glyma10g13840   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVVIVAIAATLGNLLMGWDSSTIADKMMSSTTVRKLQVVSPVPVDIDIANSVEPVHISQIAKDLNLSPNHYDLYGKYKAKVLLSVLDELQGSEDGYYVVVGGITPTPLGEGKSTTTVGLCQALGAFLDKKVVTCLRQPSQGPTFGIKGGAAGGGYSQVIPMDEFNLHLTGDIHAITAANNLLAAAIDTRIFHESTQSDKALFNRLCPPNKEGKRSFSDVMFRRLTKLGISKTNPDDLTPEEVNKFARLDIDPNSITWRRVMDINDRFLRKIAIGQGLDEKGMVRETGFDISVASEIVAVLALTTSLADMRKRLGKMVIGNTRESHFTFCFMLDLITEMAQETTRALRTGYILVYIYIYGSTNIFKKKTILFCFNHLKPIFYFCLH*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain