SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g13190

Feature Type:gene_model
Chromosome:Gm10
Start:14888205
stop:14901091
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g13190
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G41680AT Annotation by Michelle Graham. TAIR10: NADPH-dependent thioredoxin reductase C | chr2:17376349-17379028 REVERSE LENGTH=529 SoyBaseE_val: 0ISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010380GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of chlorophyll biosynthetic process SoyBaseN/AISS
GO:0010581GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of starch biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019430GO-bp Annotation by Michelle Graham. GO Biological Process: removal of superoxide radicals SoyBaseN/AISS
GO:0042744GO-bp Annotation by Michelle Graham. GO Biological Process: hydrogen peroxide catabolic process SoyBaseN/AISS
GO:0043085GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of catalytic activity SoyBaseN/AISS
GO:0045454GO-bp Annotation by Michelle Graham. GO Biological Process: cell redox homeostasis SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0004791GO-mf Annotation by Michelle Graham. GO Molecular Function: thioredoxin-disulfide reductase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0008047GO-mf Annotation by Michelle Graham. GO Molecular Function: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016671GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor SoyBaseN/AISS
GO:0050660GO-mf Annotation by Michelle Graham. GO Molecular Function: flavin adenine dinucleotide binding SoyBaseN/AISS
KOG0404 KOG Thioredoxin reductase JGI ISS
PTHR22912Panther DISULFIDE OXIDOREDUCTASE JGI ISS
PTHR22912:SF51Panther SUBFAMILY NOT NAMED JGI ISS
PF00070PFAM Pyridine nucleotide-disulphide oxidoreductase JGI ISS
PF00085PFAM Thioredoxin JGI ISS
PF07992PFAM Pyridine nucleotide-disulphide oxidoreductase JGI ISS
UniRef100_I1L9Y6UniRef Annotation by Michelle Graham. Best UniRef hit: Thioredoxin reductase n=1 Tax=Glycine max RepID=I1L9Y6_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1L9Y6UniRef Annotation by Michelle Graham. Most informative UniRef hit: Thioredoxin reductase n=1 Tax=Glycine max RepID=I1L9Y6_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g13190
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g13190 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g113100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g13190
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g13190
>Glyma10g13190.1   sequence type=CDS   gene model=Glyma10g13190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACCGCGAAGATAGGACTCGGAGTTGGTCCCGTCCCAACAACCACTCACCGAGTCACCGCCGTCGCCGCTTCTTCCTCCGCCGCATTCTCCCCGCCGCCGCACCGCCTCTTCTTCCTCAACTCGAGCCGGCCGCCCCTCCGACCTCGCCCCCTCCCCCTCCGCGTCGCCGCCGCGTCCTCCTCCCCCTCCGTCGCCGCGCCAGGAAAAGGAGTTGAGAATGTGGTAATTATAGGTTCAGGCCCTGCAGGATACACAGCGGCAATATATGCAGCACGTGCCAATTTGAAACCTGTGGTGTTTGAGGGGTACCAAGCTGGTGGTGTCCCTGGGGGACAGTTGATGACTACAACTGAAGTGGAGAATTTTCCAGGATTCCCAGATGGCATAAGTGGACCTGATCTGATGGATAGGATGCGACGGCAAGCTGAACGTTGGGGTGCAGAATTGTATCAGGAAGATGTTGAAGTTATTGATGTGAAAAGTAGTCCTTTTACTGTCCAAAGTAGTGAACGTAAGGTTAAGAGCCATACTGTCATTTATGCTACTGGAGCTACTGCAAAACGACTTAGGCTACCACGAGAAGATGAATTTTGGAGCCGAGGAATTAGTGCTTGTGCAATTTGTGATGGAGCATCACCTCTCTTCAAGGGTCAAGTTCTTGCTGTCATTGGAGGGGGGGATACAGCTACAGAAGAAGCATTATACTTAACAAAGTATGCTCGCCATGTGCATTTACTTGTACGTCGGGACCAACTGAGGGCTTCCAAAGCTATGCAAGATAGAGTGTTTGACAATCCCAATGTCACTGTGCACTTCAATACAGAGGCAGTGGACCTTGTAAGCAACACCAAAGGACAGATGTCTGGCATTTTAATAAGAAAGATTGATACTGGGGAGGAATCTGTGCTTGAGGCAAAAGGGCTGTTTTATGGCATAGGCCATTCACCAAATACTGAACTGTTGAAAGGACAAGTCGAATTAGACCACTCTGGCTATGTACAAGTTCAGGAGGGTACTGCAAAAACTTCAGTTGAAGGTGTATTTGCTGCTGGAGATGTGCAGGACCATGAATGGAGGCAAGCTATAACTGCTGCTGGATCTGGATGCGTTGCAGCTTTATCAGTTGAGAGATATCTTGTGAGCAATGATCTTCTTATAGAGTTCCATCAGCCCAAAACTGAAGAGGTTAAGAAGGAACAAACAGACAGGGATGTACACGAGGGCTTTGACATTACACTTACGAAGCATAAGGGGCAGTATGCTCTTCGAAAATTGTACCATGATAGTCCAAGGCTTATATGCGTATTATATACTTCACCAACATGTGGTCCCTGTAGGACTCTGAAGCCAATCCTTAGTAAGGTGATTGATGAATTTGATCAGAATGTTCATTTTGTCGAAATTGATATAGAGGAAGATCCAGAAATAGCTGAAGCAGCTGGAATAATGGGTACTCCATGTGTGCAGTATTTTAAAAACAAGGAGATGCTCAAGACTGTCTCAGGAGTCAAAATGAAGAGAGAATACAGAGAATTCATTGAAGCAAACAAATAA
Predicted protein sequences of Glyma10g13190
>Glyma10g13190.1   sequence type=predicted peptide   gene model=Glyma10g13190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATAKIGLGVGPVPTTTHRVTAVAASSSAAFSPPPHRLFFLNSSRPPLRPRPLPLRVAAASSSPSVAAPGKGVENVVIIGSGPAGYTAAIYAARANLKPVVFEGYQAGGVPGGQLMTTTEVENFPGFPDGISGPDLMDRMRRQAERWGAELYQEDVEVIDVKSSPFTVQSSERKVKSHTVIYATGATAKRLRLPREDEFWSRGISACAICDGASPLFKGQVLAVIGGGDTATEEALYLTKYARHVHLLVRRDQLRASKAMQDRVFDNPNVTVHFNTEAVDLVSNTKGQMSGILIRKIDTGEESVLEAKGLFYGIGHSPNTELLKGQVELDHSGYVQVQEGTAKTSVEGVFAAGDVQDHEWRQAITAAGSGCVAALSVERYLVSNDLLIEFHQPKTEEVKKEQTDRDVHEGFDITLTKHKGQYALRKLYHDSPRLICVLYTSPTCGPCRTLKPILSKVIDEFDQNVHFVEIDIEEDPEIAEAAGIMGTPCVQYFKNKEMLKTVSGVKMKREYREFIEANK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo