Glyma10g12915 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g12915): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g12915): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g12915

Feature Type:	gene_model
Chromosome:	Gm10
Start:	14587063
stop:	14587732
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g12915

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G31070	AT	Annotation by Michelle Graham. TAIR10: N-acetylglucosamine-1-phosphate uridylyltransferase 1 \| chr1:11084951-11086334 FORWARD LENGTH=153	SoyBase	E_val: 6.00E-48	ISS
GO:0006047	GO-bp	Annotation by Michelle Graham. GO Biological Process: UDP-N-acetylglucosamine metabolic process	SoyBase	N/A	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0019276	GO-bp	Annotation by Michelle Graham. GO Biological Process: UDP-N-acetylgalactosamine metabolic process	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0003977	GO-mf	Annotation by Michelle Graham. GO Molecular Function: UDP-N-acetylglucosamine diphosphorylase activity	SoyBase	N/A	ISS
GO:0016779	GO-mf	Annotation by Michelle Graham. GO Molecular Function: nucleotidyltransferase activity	SoyBase	N/A	ISS
GO:0052630	GO-mf	Annotation by Michelle Graham. GO Molecular Function: UDP-N-acetylgalactosamine diphosphorylase activity	SoyBase	N/A	ISS
PTHR11952	Panther	UDP- GLUCOSE PYROPHOSPHORYLASE	JGI		ISS
PTHR11952:SF2	Panther	UDP-N-ACTEYLGLUCOSAMINE PYROPHOSPHORYLASE 1	JGI		ISS
UniRef100_D7LHR5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: UTP--glucose-1-phosphate uridylyltransferase family protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7LHR5_ARALL	SoyBase	E_val: 2.00E-45	ISS
UniRef100_UPI000233D810	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233D810 related cluster n=1 Tax=unknown RepID=UPI000233D810	SoyBase	E_val: 3.00E-79	ISS

Expression Patterns of Glyma10g12915

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g12915 not represented in the dataset	Glyma10g12915 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g12915 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g114200	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g12915

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g12915

Limit To All Plant Sequences

>Glyma10g12915.1   sequence type=CDS   gene model=Glyma10g12915   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGGAGCCATCGTCAGTGGGATTCGAAGGCAACGACGTTGTTCCACCGCAAGCTCTTCTCCAGAGACTGAAAGACTACGATCAAGAACACGCTTTCGCCCTCTGGTACGAGCTCTCTTACGAGGAACGCGAGTTTCTCGTCAAGGACATTGAGAGTTTAGATCTTTCAAGAATTGACCGGATTATTCGGTGCTCGCTGCGATCTCAAGGACTGCCGGTGGCGGCCATTGAGCCTGTGTCGGAGAGCAGTGTGTCGACGGTGGTGGAGAGAAGTCAAGAGGATCGAGAGAGATGGTGGAAAATGGGATTGAAGGCCATTTCTGATGGCGAATTAGCTGTATTGCTTTTATCTGGTGGCCAG

Predicted protein sequences of Glyma10g12915

Limit To All Plant Sequences

>Glyma10g12915.1   sequence type=predicted peptide   gene model=Glyma10g12915   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MREPSSVGFEGNDVVPPQALLQRLKDYDQEHAFALWYELSYEEREFLVKDIESLDLSRIDRIIRCSLRSQGLPVAAIEPVSESSVSTVVERSQEDRERWWKMGLKAISDGELAVLLLSGGQ

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain