SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g07930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g07930): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g07930

Feature Type:gene_model
Chromosome:Gm10
Start:6746832
stop:6751037
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g07930
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G28510AT Annotation by Michelle Graham. TAIR10: Optic atrophy 3 protein (OPA3) | chr1:10024036-10025939 FORWARD LENGTH=171 SoyBaseE_val: 5.00E-76ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG3335 KOG Predicted coiled-coil protein JGI ISS
PTHR12499Panther OPTIC ATROPHY 3 PROTEIN (OPA3) JGI ISS
PF07047PFAM Optic atrophy 3 protein (OPA3) JGI ISS
UniRef100_B9SGN9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Optic atrophy 3 protein, putative n=1 Tax=Ricinus communis RepID=B9SGN9_RICCO SoyBaseE_val: 1.00E-72ISS
UniRef100_I1L999UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L999_SOYBN SoyBaseE_val: 3.00E-116ISS

Expression Patterns of Glyma10g07930
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g07930 not represented in the dataset
Glyma10g07930 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g07930 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g068700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g07930
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g07930
>Glyma10g07930.1   sequence type=CDS   gene model=Glyma10g07930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGCTGCCACTGCTGAAGCTGGGAACGCTGGCCGTGAAAACCCTAAGCAAACCCGTGGCGAGCAGACTGAAGCAGCAGGCCGCTCTTCACCCCAGATTCCGCGAACTCATCGTTAGAATGGCTCAGTCTAATCATCAAATCACGACTAAGATGCAAAGGCGCATTTACGGCCACGCCACAGACGTTGAGATTCGCCCCTTGAACGAGGAAAAGGCCGTTCAAGCCGCCGTTGACCTTATCGGAGAACTCTTCGTCTTCTCGGTTGCAGGAGTTCTCTTGATCTTTGAGGTACAAAGAAGTGCTAGATCTGAGGCAAGAAAGGAGGAGCAACGAAAGCAAGAGCTGCAGGACGTGAAGCAAAAAAATGAAAACTTGGCAGAAGAAGTAGAACTTCTTAAGCATAGAATTCAAGAACTGGAACAGATGGCGAGGGGACGAGGATTGATTGGCATACTAAACTTCAGAAATGGTAATACAGAAATTGGAAAGGCAGAGAAAACTGCTTGA
Predicted protein sequences of Glyma10g07930
>Glyma10g07930.1   sequence type=predicted peptide   gene model=Glyma10g07930   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVLPLLKLGTLAVKTLSKPVASRLKQQAALHPRFRELIVRMAQSNHQITTKMQRRIYGHATDVEIRPLNEEKAVQAAVDLIGELFVFSVAGVLLIFEVQRSARSEARKEEQRKQELQDVKQKNENLAEEVELLKHRIQELEQMARGRGLIGILNFRNGNTEIGKAEKTA*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo