SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g07210

Feature Type:gene_model
Chromosome:Gm10
Start:5912077
stop:5918852
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g07210
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G53130AT Annotation by Michelle Graham. TAIR10: Cytochrome P450 superfamily protein | chr3:19692812-19695278 FORWARD LENGTH=539 SoyBaseE_val: 0ISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0016556GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA modification SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0005506GO-mf Annotation by Michelle Graham. GO Molecular Function: iron ion binding SoyBaseN/AISS
GO:0009055GO-mf Annotation by Michelle Graham. GO Molecular Function: electron carrier activity SoyBaseN/AISS
GO:0009974GO-mf Annotation by Michelle Graham. GO Molecular Function: zeinoxanthin epsilon hydroxylase activity SoyBaseN/AISS
GO:0016705GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen SoyBaseN/AISS
GO:0019825GO-mf Annotation by Michelle Graham. GO Molecular Function: oxygen binding SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
KOG0157 KOG Cytochrome P450 CYP4/CYP19/CYP26 subfamilies JGI ISS
PTHR24290Panther FAMILY NOT NAMED JGI ISS
PTHR24290:SF151Panther JGI ISS
PF00067PFAM Cytochrome P450 JGI ISS
UniRef100_G7IA76UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome P450 monooxygenase CYP97C10 n=1 Tax=Medicago truncatula RepID=G7IA76_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1L941UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L941_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g07210
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g07210
ParalogEvidenceComments
Glyma13g21110 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g07210 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g062900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g07210
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g07210
>Glyma10g07210.1   sequence type=CDS   gene model=Glyma10g07210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTTCCTCACTCTCCCATCTCACACCTCTCTCTCTCTTCCTTCCCCGCAGACCCACCGTTTCCTCTCCCACTCCAAAACCTTATCGCTTCTCCGTCAAATCCTCCATCAACAAACCCCCCGACACCGGCACCGGCACCTCCAAGCCCAGCTCTTGGTTCAGCCCCGACTGGCTCACCTCCCTCTCCCGCTCCCTCGCCGCCGGCAACGACGACTCCGGCATTCCCCTCGCCTCCGCCAAGCTCGACGACGTCTCTGATCTCCTCGGCGGCGCGCTCTTCCTCCCTCTCTTCAAGTGGATGCAGGACTACGGCCCCATCTACCGCCTCGCCGCCGGCCCCCGAAACTTCGTCGTCGTTAGCGACCCCGCCATCGCCAAGCACGTGCTCAGGAACTACGGCAAATACGCCAAGGGTCTTGTTGCCGAGGTCTCCGAGTTCCTGTTTGGGTCCGGTTTCGCCATCGCCGAAGGTCCTCTCTGGACGGCAAGGCGCAGGGCTGTGGTTCCATCTCTTCATAAACGGTACTTGTCTGTTATAGTGGATAGGGTGTTTTGTAGATGTGCTGAGAGATTAGTGGAGAAGCTACAACCTGATGCACTTAATGGAACTGCTGTTAACATGGAGGCAAAGTTTTCGCAGTTGACTCTTGATGTTATTGGTTTATCTGTTTTTAATTATAACTTTGACTCGCTCAACATGGACAGTCCTGTTATTGAGGCTGTTTACACTGCATTAAAAGAGGCAGAGGCTCGATCAACTGATCTTTTACCGTATTGGAAGTTTAAATTTCTTTGTAAGATAATTCCGAGACAAATAAAGGCTGAAGAGGCTGTTAGCATTATCAGGAAAACTGTTGAAGATCTTATTGAAAAGTGTAGAGAGATTGTAGAATCTGAGGGTGAAAGAATTGATGTCGAGGAATATGTGAATGACAGTGACCCTAGTATCCTTCGGTTCTTGCTTGCCAGCAGAGAAGAGGTTTCCAGTGTGCAATTAAGGGATGATCTTTTGTCACTATTAGTTGCTGGTCATGAGACCACCGGTTCAGTGCTGACCTGGACACTTTATCTTCTAAGCAAGGATTCTTCCTCATTGGCAAAAGCACAAGAAGAGGTAGACAGAGTTTTACAGGGAAGGCGACCTACCTATGAAGATATTAAAAATCTTAAGTTCTTGACACGCTGCATTATTGAGTCACTCCGTCTCTATCCACATCCTCCCGTATTGATAAGAAGAGCTCAAGTCCCGGATGAGCTTCCAGGTGGTTACAAACTCAATGCTGGTCAAGATATTATGATCTCTGTATACAACATACATCGTTCTTCTGAGGTCTGGGATAGGGCTGAAGAGTTTGCACCAGAAAGATTTGATTTGGATGGTCCAGTTCCAAATGAAACAAATACAGATTTCAGATTCATTCCATTCAGTGGAGGTCCCCGCAAATGTGTTGGTGATCAGTTTGCTTTAATGGAAGCTATAGTTGCTCTTGCAATCTTTCTACAGCACATGAACTTCGAACTAGTTCCTGATCAGAATGTCAGTATGACTACAGGAGCAACAATACATACAACAAATGGCTTGTACATGAAACTGAGCCGACGGTTGAAATAG
Predicted protein sequences of Glyma10g07210
>Glyma10g07210.1   sequence type=predicted peptide   gene model=Glyma10g07210   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSSSLSHLTPLSLFLPRRPTVSSPTPKPYRFSVKSSINKPPDTGTGTSKPSSWFSPDWLTSLSRSLAAGNDDSGIPLASAKLDDVSDLLGGALFLPLFKWMQDYGPIYRLAAGPRNFVVVSDPAIAKHVLRNYGKYAKGLVAEVSEFLFGSGFAIAEGPLWTARRRAVVPSLHKRYLSVIVDRVFCRCAERLVEKLQPDALNGTAVNMEAKFSQLTLDVIGLSVFNYNFDSLNMDSPVIEAVYTALKEAEARSTDLLPYWKFKFLCKIIPRQIKAEEAVSIIRKTVEDLIEKCREIVESEGERIDVEEYVNDSDPSILRFLLASREEVSSVQLRDDLLSLLVAGHETTGSVLTWTLYLLSKDSSSLAKAQEEVDRVLQGRRPTYEDIKNLKFLTRCIIESLRLYPHPPVLIRRAQVPDELPGGYKLNAGQDIMISVYNIHRSSEVWDRAEEFAPERFDLDGPVPNETNTDFRFIPFSGGPRKCVGDQFALMEAIVALAIFLQHMNFELVPDQNVSMTTGATIHTTNGLYMKLSRRLK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo