SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g06770

Feature Type:gene_model
Chromosome:Gm10
Start:5488106
stop:5490621
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g06770
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G09890AT Annotation by Michelle Graham. TAIR10: Ankyrin repeat family protein | chr3:3032678-3034158 FORWARD LENGTH=206 SoyBaseE_val: 1.00E-77ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
KOG4214 KOG Myotrophin and similar proteins JGI ISS
PTHR24136Panther FAMILY NOT NAMED JGI ISS
PTHR24136:SF216Panther JGI ISS
PF00023PFAM Ankyrin repeat JGI ISS
UniRef100_B9S0D5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ankyrin repeat-containing protein, putative n=1 Tax=Ricinus communis RepID=B9S0D5_RICCO SoyBaseE_val: 5.00E-92ISS
UniRef100_I1L918UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L918_SOYBN SoyBaseE_val: 6.00E-142ISS

Expression Patterns of Glyma10g06770
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g06770
ParalogEvidenceComments
Glyma13g20960 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g06770 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g059800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g06770
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g06770
>Glyma10g06770.1   sequence type=CDS   gene model=Glyma10g06770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAGTTCCAGGGAGGCGCAACGGCATGAACGACGACGAAGAGGAATTAGACGACAACGCCCTTTTCGAAGAACAAGGTGCCGTCGAAGACGACGCCGATACCCCTCCTCACCTCCGCGACCTCTCCGCCGCCGCTCAGCTAGGCGACGTCCACGCCCTCCGTATCGCTCTTGATAACTTGACTGGTAGTATTGATGAGCCAGTGGAGGATGGGGATACTGCTCTTCATTTGACATGTCTATATGGCCATTTGGCTTGTGTCCAGCTGCTACTAGAAAGAGGGGCGAACATTGAGGCTAATGATGAAGATGGTGCTATTCCTTTGCACGATGCTTGTGCAGGAGGATTTACTGAGATTGTCCAACTGCTGCTTAGCAGAGCTAATGATGCTGAACATATAAAGAGAATGCTAGAATCAGTTGATTCTGAGGGTGATACCCCTCTCCATCACGCTGCTAGAGGTGAGCATGTTGAAGTAATTAGGTTGTTGCTGTCTAATGGTGCATCTCCCACAAAGGCTAACTTATACGGAAAGGCCCCTGCAGATTTGCCTGAACAGGAAGCTGCTCGGAGGCTGCTTGAAGCTGCAGCTCTTGCCATGGCATGCCAATAG
Predicted protein sequences of Glyma10g06770
>Glyma10g06770.1   sequence type=predicted peptide   gene model=Glyma10g06770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAVPGRRNGMNDDEEELDDNALFEEQGAVEDDADTPPHLRDLSAAAQLGDVHALRIALDNLTGSIDEPVEDGDTALHLTCLYGHLACVQLLLERGANIEANDEDGAIPLHDACAGGFTEIVQLLLSRANDAEHIKRMLESVDSEGDTPLHHAARGEHVEVIRLLLSNGASPTKANLYGKAPADLPEQEAARRLLEAAALAMACQ*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo