SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g06620

Feature Type:gene_model
Chromosome:Gm10
Start:5369774
stop:5372629
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g06620
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G37220AT Annotation by Michelle Graham. TAIR10: RNA-binding (RRM/RBD/RNP motifs) family protein | chr2:15634980-15636331 REVERSE LENGTH=289 SoyBaseE_val: 3.00E-91ISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0045087GO-bp Annotation by Michelle Graham. GO Biological Process: innate immune response SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
GO:0008266GO-mf Annotation by Michelle Graham. GO Molecular Function: poly(U) RNA binding SoyBaseN/AISS
KOG0131 KOG Splicing factor 3b, subunit 4 JGI ISS
PTHR24012Panther FAMILY NOT NAMED JGI ISS
PTHR24012:SF56Panther SUBFAMILY NOT NAMED JGI ISS
PF00076PFAM RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) JGI ISS
UniRef100_G7IBJ3UniRef Annotation by Michelle Graham. Most informative UniRef hit: 30 kDa ribonucleoprotein n=1 Tax=Medicago truncatula RepID=G7IBJ3_MEDTR SoyBaseE_val: 1.00E-112ISS
UniRef100_UPI00018C6E90UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00018C6E90 related cluster n=1 Tax=unknown RepID=UPI00018C6E90 SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g06620
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g06620
ParalogEvidenceComments
Glyma13g20830 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g06620 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g058500 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g06620
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g06620
>Glyma10g06620.1   sequence type=CDS   gene model=Glyma10g06620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTACCTCCGCAGCTTCCCTCGCACTCCCAACCCTCACTCTCCGAACCCGACAACCTCTATGTTCTCCCCAATGCTTCTCCTCGTCCCTCTCCCTCACACCCAACAACAAACCCATTTCCATTTCTGCTGTTTTTCTCAAACCAACAACTCTGTCGTCGTCTCGCTTCGTTCCCCACGTCGTGGTGTCGTCGGATTTGGGGCAGGAGGAGGACACCTTCAGTGACGGAGACGGCCCCAGCTTCTCCCCCGACCTTAAGCTCTTTGTCGGGAATCTTCCGTTCAACGTCGACAGCGCGCAGCTCGCGGAGCTCTTTGAGAGTGCCGGGAATGTGGAGGTGGTTGAGGTGATTTATGATAAGACTACTGGGAGGAGCAGGGGGTTTGGGTTTGTCACCATGTCTTCGGTTGAGGAAGCTGAAGCGGCTGCTCAGCAGTTCAATGGCTATGAACTTGATGGAAGAGCATTGAGAGTGAATTCTGGGCCACCTCCTGCTCGGAATGAGAGTGCTCCTCGTTTTAGAGGTGGTTCTTCTTTCGGTTCCAGAGGTGGTGGTCCTTCAGATAGTGAAAACCGTGTTCATGTAAGTAATCTTGCTTGGGGTGTTGACAATGTAGCACTTAAGTCATTGTTTCGTGAACAAGGGAATGTCTTGGAAGCTAGGGTAATCTATGACAGGGAAAGTGGACGATCAAGAGGCTTTGGATTTGTGACTTTCAGTAGCCCTGATGAGGTCAACAGTGCAATTCAGTCCTTAAATGGCGTGGACTTGAATGGCAGAGCTATACGAGTCTCATTAGCAGATTCCAAGCCCAAGCAGTTCTGA
Predicted protein sequences of Glyma10g06620
>Glyma10g06620.1   sequence type=predicted peptide   gene model=Glyma10g06620   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSTSAASLALPTLTLRTRQPLCSPQCFSSSLSLTPNNKPISISAVFLKPTTLSSSRFVPHVVVSSDLGQEEDTFSDGDGPSFSPDLKLFVGNLPFNVDSAQLAELFESAGNVEVVEVIYDKTTGRSRGFGFVTMSSVEEAEAAAQQFNGYELDGRALRVNSGPPPARNESAPRFRGGSSFGSRGGGPSDSENRVHVSNLAWGVDNVALKSLFREQGNVLEARVIYDRESGRSRGFGFVTFSSPDEVNSAIQSLNGVDLNGRAIRVSLADSKPKQF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo