SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma10g05830

Feature Type:gene_model
Chromosome:Gm10
Start:4559665
stop:4561217
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G03240AT Annotation by Michelle Graham. TAIR10: polyubiquitin 3 | chr5:771976-772896 REVERSE LENGTH=306 SoyBaseE_val: 0ISS
GO:0006464GO-bp Annotation by Michelle Graham. GO Biological Process: cellular protein modification process SoyBaseN/AISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0006623GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to vacuole SoyBaseN/AISS
GO:0010224GO-bp Annotation by Michelle Graham. GO Biological Process: response to UV-B SoyBaseN/AISS
GO:0016192GO-bp Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
KOG0005 KOG Ubiquitin-like protein JGI ISS
PTHR10666Panther UBIQUITIN JGI ISS
PF00240PFAM Ubiquitin family JGI ISS
UniRef100_A1X1E5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Polyubiquitin n=1 Tax=Noccaea caerulescens RepID=A1X1E5_THLCA SoyBaseE_val: 0ISS
UniRef100_I1L8T7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L8T7_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma13g20197 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g051100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma10g05830.1   sequence type=CDS   gene model=Glyma10g05830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAGATCTTCGTGAAAACCCTAACTGGCAAGACGATCACCTTGGAGGTGGAGTCCTCTGACACCATCGACAACGTGAAGGCCAAAATCCAAGACAAGGAGGGCATTCCTCCGGATCAACAGCGTTTAATCTTCGCCGGAAAACAGCTCGAAGACGGCAGAACCCTCGCCGACTACAACATCCAAAAGGAGTCCACGCTCCACCTCGTCCTCCGCCTCCGCGGCGGCATGCAAATCTTCGTCAAAACCCTTACTGGCAAAACAATCACGCTAGAGGTGGAGTCCTCCGACACAATCGATAACGTGAAAGCCAAGATTCAAGATAAGGAAGGGATTCCTCCGGATCAGCAACGTTTGATCTTCGCCGGAAAACAACTCGAAGACGGCAGAACCCTCGCCGATTACAATATCCAGAAAGAATCGACTCTGCATTTGGTGCTTCGTCTCCGCGGAGGGATGCAGATCTTCGTGAAAACCCTAACCGGCAAAACGATTACGCTAGAGGTAGAGTCCTCTGACACAATCGATAACGTGAAAGCGAAGATCCAGGATAAGGAAGGTATTCCACCGGATCAGCAACGTCTTATCTTCGCCGGAAAGCAGTTGGAAGACGGCAGAACCCTCGCCGATTACAATATTCAAAAGGAATCGACGCTTCATCTGGTGCTTCGTCTCCGCGGAGGGATGCAGATCTTCGTGAAGACGCTCACCGGAAAAACGATTACTCTGGAGGTGGAGAGTTCTGATACGATCGATAACGTGAAGGCAAAGATTCAGGATAAGGAGGGGATTCCACCGGATCAGCAGCGTCTTATCTTCGCAGGGAAGCAGCTTGAGGATGGACGCACGCTTGCAGATTATAATATTCAGAAGGAGTCCACGCTTCACCTTGTCCTCAGGCTCCGTGGTGGTGATTTCTAG

>Glyma10g05830.1   sequence type=predicted peptide   gene model=Glyma10g05830   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGMQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGMQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGMQIFVKTLTGKTITLEVESSDTIDNVKAKIQDKEGIPPDQQRLIFAGKQLEDGRTLADYNIQKESTLHLVLRLRGGDF*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo