SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g05270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g05270): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g05270

Feature Type:gene_model
Chromosome:Gm10
Start:4078617
stop:4080478
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g05270
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G02610AT Annotation by Michelle Graham. TAIR10: Ribosomal L29 family protein | chr5:587611-588547 FORWARD LENGTH=123 SoyBaseE_val: 1.00E-70ISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0042254GO-bp Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009506GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasmodesma SoyBaseN/AISS
GO:0022625GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic large ribosomal subunit SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG3436 KOG 60S ribosomal protein L35 JGI ISS
PTHR13872Panther 60S RIBOSOMAL PROTEIN L35 JGI ISS
PTHR13872:SF11Panther SUBFAMILY NOT NAMED JGI ISS
PF00831PFAM Ribosomal L29 protein JGI ISS
UniRef100_I1M4R7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1M4R7_SOYBN SoyBaseE_val: 4.00E-77ISS
UniRef100_Q9M5L0UniRef Annotation by Michelle Graham. Most informative UniRef hit: 60S ribosomal protein L35 n=1 Tax=Euphorbia esula RepID=RL35_EUPES SoyBaseE_val: 2.00E-72ISS

Expression Patterns of Glyma10g05270
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g05270 not represented in the dataset
Glyma10g05270 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g05270 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g045900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g05270
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g05270
>Glyma10g05270.1   sequence type=CDS   gene model=Glyma10g05270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCGAGGATAAAGGTTTACGAGCTTAGGAACAAGACGAAGGCGGAGCTGCTGAACCAGCTGAAGGATCTCAAGGCGGAGCTTGCCCTGCTCCGCGTCGCCAAGGTCACCGGCGGCGCCCCCAACAAGCTCTCCAAAATCAAGGTGGTGAGGCTTTCGATAGCGCAGGTTTTGACGGTTATTTCCCAAAAGCAGAAAGCGGCGCTGAGAGAGGCTTACAAGAAGAAGAAGTATTTGCCCCTTGACCTACGTCCCAAAAAGACCCGCGCCATTCGGAGACGCCTTACCAAACACCAGGCGTCTTTGAAGACGGAACGTGAGAAAAAGAAGGAGCTGTACTTTCCACTAAGAAAGTATGCGATCAAAGTTTAG
Predicted protein sequences of Glyma10g05270
>Glyma10g05270.1   sequence type=predicted peptide   gene model=Glyma10g05270   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARIKVYELRNKTKAELLNQLKDLKAELALLRVAKVTGGAPNKLSKIKVVRLSIAQVLTVISQKQKAALREAYKKKKYLPLDLRPKKTRAIRRRLTKHQASLKTEREKKKELYFPLRKYAIKV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo