SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g04396

Feature Type:gene_model
Chromosome:Gm10
Start:3386328
stop:3386837
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g04396
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G18760AT Annotation by Michelle Graham. TAIR10: chromatin remodeling 8 | chr2:8129154-8133502 FORWARD LENGTH=1187 SoyBaseE_val: 2.00E-38ISS
GO:0006281GO-bp Annotation by Michelle Graham. GO Biological Process: DNA repair SoyBaseN/AISS
GO:0010332GO-bp Annotation by Michelle Graham. GO Biological Process: response to gamma radiation SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0004386GO-mf Annotation by Michelle Graham. GO Molecular Function: helicase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
UniRef100_B9SV29UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA repair and recombination protein RAD26, putative n=1 Tax=Ricinus communis RepID=B9SV29_RICCO SoyBaseE_val: 1.00E-57ISS
UniRef100_I1L8F2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1L8F2_SOYBN SoyBaseE_val: 7.00E-113ISS

Expression Patterns of Glyma10g04396
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g04396 not represented in the dataset
Glyma10g04396 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g04396 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g038200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g04396
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g04396
>Glyma10g04396.1   sequence type=CDS   gene model=Glyma10g04396   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGCAAGCATCCCAGGTTGCACAAAGAGCTGCAGAAGCTTTACGTCAGTCACGAATGGTCCGAAGCCATGATAGCAAAGCATCTAACGAATTACCCAACAAGGGAACTAACAAGATCAATGGATTTGCTGCTGGGGAATCTTCTGGTAAAGCATTATCTTCCGCCGAACTATTGGCTCAAATTCGAGGTAACCAAGAGAAAGCCATTGGTGCCGGGCTTGAACATCAGTTTGGTGTGTTGTCAAGTTCCACTAATCAAGCAAGATCTGTAGATGCTAGATCTTCCATGGCTACTGAAAATTCATCCGTACAACCTGAAGTATTGATTCGGAAAATCTGTACTTTTATACAACAACGAGGTGGTAGTTCCGATTCAGCCAGCATAGTTCAGTATTTCAAGGACCGTATTCCCTCAAAAGATGTTGTGCTGTTTAAGAATCTGTTAAAGGAAATTGCTACTCTGCATAAAGGATCAAATTGGGTTCTGAAACCAGACTACCAATTCTGA
Predicted protein sequences of Glyma10g04396
>Glyma10g04396.1   sequence type=predicted peptide   gene model=Glyma10g04396   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEQASQVAQRAAEALRQSRMVRSHDSKASNELPNKGTNKINGFAAGESSGKALSSAELLAQIRGNQEKAIGAGLEHQFGVLSSSTNQARSVDARSSMATENSSVQPEVLIRKICTFIQQRGGSSDSASIVQYFKDRIPSKDVVLFKNLLKEIATLHKGSNWVLKPDYQF*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo