SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g03241

Feature Type:gene_model
Chromosome:Gm10
Start:2347446
stop:2351855
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g03241
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G63190AT Annotation by Michelle Graham. TAIR10: ribosome recycling factor, chloroplast precursor | chr3:23342861-23344640 REVERSE LENGTH=275 SoyBaseE_val: 6.00E-110ISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009073GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process SoyBaseN/AISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0009790GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development SoyBaseN/AISS
GO:0009817GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus, incompatible interaction SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019408GO-bp Annotation by Michelle Graham. GO Biological Process: dolichol biosynthetic process SoyBaseN/AISS
GO:0032544GO-bp Annotation by Michelle Graham. GO Biological Process: plastid translation SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0005507GO-mf Annotation by Michelle Graham. GO Molecular Function: copper ion binding SoyBaseN/AISS
KOG4759 KOG Ribosome recycling factor JGI ISS
PTHR20982Panther RIBOSOME RECYCLING FACTOR JGI ISS
PF01765PFAM Ribosome recycling factor JGI ISS
UniRef100_B7FI72UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ribosome-recycling factor n=1 Tax=Medicago truncatula RepID=B7FI72_MEDTR SoyBaseE_val: 3.00E-117ISS
UniRef100_C6TCH7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TCH7_SOYBN SoyBaseE_val: 4.00E-132ISS

Expression Patterns of Glyma10g03241
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g03241 not represented in the dataset
Glyma10g03241 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g03241
ParalogEvidenceComments
Glyma02g16590 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g03241 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g026900 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g03241
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g03241
>Glyma10g03241.1   sequence type=CDS   gene model=Glyma10g03241   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTTATGGCCTTGTGGAGTGGCATTGCAAATTGGCAAAGAAAAAAAAAAGAGTGGAGAAAATTGTTATCCACAACACAACATCATCAACGTTACACAAGTCTCTCTGATGGCAACCTCGACCTCTTTCTCTCCGACAGCCTCTGTCCGCTCCATCATCTTCCAAAAGCAAAACCCTCCCAAAGCCCTTCTTCTTCTCTCCCAGCAGCGCTCCTTCGCCTCTTCCGCAAGCTATGCAACTCTCAAGCTCCCTCGCAGACCCCTCCTTTCCAAGGGAGAACGCCACTTGTGAGGGCTGCTACTATCGAAGAAATTGAAGCCGAAAAAGCAGCAATCGAGAAAGATGCTAAAAGCAGGATGGATAGGACTATTGATAATGTCCGTACAAATTTCAGTTCCATAAGGACAGGGAGAGCAAACCCAGCCATGCTTGACAAAATTGAGGTGGAATACTATGGAAGTCCAGTTAGCTTGAAGAGCATTGCTCAAATTAGCACTCCTGATGCCAGTTCTCTTTTGGTACAGCCATATGACAAATCAAGCTTGAAGGCTATAGAGAAAACCATAGTTAGCTCTGATCTTGGTATGACTCCAAATAATGATGGAGAATCGATACAATTGAGAATCCCACAGTTGACATCTGATAGGAGGAAGGAACTATCGAAGATAGTGGCTAAACAAGCTGAAGAAGGGAAGGTGGCTTTGAGGAATATAAGGAGAGATGCATTAAAAGCTTATGATAAACTTGAGAAGGAGAAAAAGCTCTCGGAAGATAATGTGAAGGATTTGTCAAGTGATTTGCAGAAGCTGACAGATGAGTATATGAAGAAAGTTGACACCATCTTCAAACAGAAAGAAAAGGAGTTGCTGACAGTTTGA
Predicted protein sequences of Glyma10g03241
>Glyma10g03241.1   sequence type=predicted peptide   gene model=Glyma10g03241   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVMALWSGIANWQRKKKEWRKLLSTTQHHQRYTSLSDGNLDLFLSDSLCPLHHLPKAKPSQSPSSSLPAALLRLFRKLCNSQAPSQTPPFQGRTPLVRAATIEEIEAEKAAIEKDAKSRMDRTIDNVRTNFSSIRTGRANPAMLDKIEVEYYGSPVSLKSIAQISTPDASSLLVQPYDKSSLKAIEKTIVSSDLGMTPNNDGESIQLRIPQLTSDRRKELSKIVAKQAEEGKVALRNIRRDALKAYDKLEKEKKLSEDNVKDLSSDLQKLTDEYMKKVDTIFKQKEKELLTV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo