Glyma10g03130 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g03130

Feature Type:	gene_model
Chromosome:	Gm10
Start:	2228004
stop:	2230799
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g03130

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G46610	AT	Annotation by Michelle Graham. TAIR10: Aluminium activated malate transporter family protein \| chr5:18913115-18915736 REVERSE LENGTH=543	SoyBase	E_val: 4.00E-57	ISS
GO:0010044	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to aluminum ion	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
PF11744	PFAM	Aluminium activated malate transporter	JGI		ISS
UniRef100_O49696-2	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Isoform 2 of Aluminum-activated malate transporter 12 n=1 Tax=Arabidopsis thaliana RepID=O49696-2	SoyBase	E_val: 4.00E-56	ISS
UniRef100_UPI000233C677	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233C677 related cluster n=1 Tax=unknown RepID=UPI000233C677	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma10g03130

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g03130

Paralog	Evidence	Comments
Glyma02g16680	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g03130 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g025900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g03130

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g03130

Limit To All Plant Sequences

>Glyma10g03130.2   sequence type=CDS   gene model=Glyma10g03130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAATCAACGCATGTAATATCCATTTTGAATGGAGAAGAGAATGTTGTTCCAAGGAAGAATGATAACACATTCCAATTTTCACTTCCACCCGTTTTTTCCCGTCTTAGAGAAAACAAAAAAGACACTAAAAAAATTATCCACAGCATCAAAGTTGGAATCTCCCTTGTATTGATTTCACTTCTGTACTTCGTGGATCCTCTCTATGAGCAAGTTGGAGATAATGCTATATGGGCTATCATGACTGTTGTGGTCACCTTTGAATTTTTCGCAGGAGCTACGCTAGGAAAAGGTTTAAATCGTGGAATTGGAACTGTATTAGGAGGTGGACTGGGTTGCATAGCCGCAGTTTTGGCGCAAAACGTTGGTAATGGTGGAGTTGCCAACTTGATTATCATTGGTACTTTTGTATTTATCTTTGGAACATTTGCGACATATTGCCGCCTATTCCCTAGTGTGAAGAAGAGGTACAATTACGGAGTGATGATCTTTATCCTCACTTTTAATTTGGTTGTGGTGTCTGGTGTGCGCATTCAAGATCAGAAAGTTTGGGAAATAGCACGTGAACGTCTTTTAACAATTGTCATGGATTTCGTTGTGTGCATTTGTGTTAGCTTGTTGGTTTTCCCCTACTGGGCCAGCGATGAACTTCATGATTCTACTGTCTATAGATTTCAACACCTTGCCAATGCATTACAAGACGTTTATCATCACCCAAAGATTGGAGAGGTTCTTCGAGAACTTGCTGCAATTATTCTTGCTCTGGGAGGTTGCCTCCAAGCCTCAACTACGGTATGTAATTAA

Predicted protein sequences of Glyma10g03130

Limit To All Plant Sequences

>Glyma10g03130.2   sequence type=predicted peptide   gene model=Glyma10g03130   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MESTHVISILNGEENVVPRKNDNTFQFSLPPVFSRLRENKKDTKKIIHSIKVGISLVLISLLYFVDPLYEQVGDNAIWAIMTVVVTFEFFAGATLGKGLNRGIGTVLGGGLGCIAAVLAQNVGNGGVANLIIIGTFVFIFGTFATYCRLFPSVKKRYNYGVMIFILTFNLVVVSGVRIQDQKVWEIARERLLTIVMDFVVCICVSLLVFPYWASDELHDSTVYRFQHLANALQDVYHHPKIGEVLRELAAIILALGGCLQASTTVCN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain