Glyma10g02621 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g02621

Feature Type:	gene_model
Chromosome:	Gm10
Start:	1849482
stop:	1852754
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g02621

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G47890	AT	Annotation by Michelle Graham. TAIR10: B-box type zinc finger protein with CCT domain \| chr2:19608245-19609476 FORWARD LENGTH=332	SoyBase	E_val: 3.00E-67	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009805	GO-bp	Annotation by Michelle Graham. GO Biological Process: coumarin biosynthetic process	SoyBase	N/A	ISS
GO:0009963	GO-bp	Annotation by Michelle Graham. GO Biological Process: positive regulation of flavonoid biosynthetic process	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
KOG1601	KOG	GATA-4/5/6 transcription factors	JGI		ISS
PF06203	PFAM	CCT motif	JGI		ISS
UniRef100_D0EP04	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: CONSTANS-like zinc finger protein n=1 Tax=Glycine max RepID=D0EP04_SOYBN	SoyBase	E_val: 2.00E-117	ISS
UniRef100_UPI000233C66B	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI000233C66B related cluster n=1 Tax=unknown RepID=UPI000233C66B	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma10g02621

Locus	Gene Symbol	Protein Name
	COL12a	Constans-like 12a

Expression Patterns of Glyma10g02621

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g02621 not represented in the dataset	Glyma10g02621 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g02621

Paralog	Evidence	Comments
Glyma02g17181	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g02621 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g021400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g02621

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g02621

Limit To All Plant Sequences

>Glyma10g02621.1   sequence type=CDS   gene model=Glyma10g02621   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGATGAGTGGTTCTCCTTCTCCAAATTCAAAACAGAGAACATGCGACTATTGTGGGGACTTCACGGCTCTTCTGTATTGCAGTGCCGATTCTGCGAAGCTATGTTTCTTCTGTGACCGCAAAGTTCACTCCCCAAACCAGCTTTTCTCCAAGCACACGCGAGCGCAGCTCTGTGATTCGTGTGGAGATTCCCCTGCTTCGGTGCTCTGTTCTGCAGAGAACTCTGTTCTTTGCCATAACTGTGACTGCGAAAAGCACAAACATTTGGCGTCTGAAGTGCACCAACGAAAACCCCTCGAGGGGTTCTCGGGGTGCCCTTCTGTGACTGAGTTGTTAACGATTCTTGGTCTTTCTGAAAAATCTCTGCTTTCAAATGAGGGGACTTCCCAGATTGATTACGACCTTTCGGATTTGCACGTGTGGAGTGCTCCTTCTGTTAACGGTCTTGAATATTTGATCACTTCCACAGCTTCTTCTCATAAGAATCGTAAGAGTGCGTTTGGGAGACACAAAGAAGAGATTCTTAGTCAACTCCGTGAGCTAATAAAGTTGGAGCCCGACTTGATTCATGGAGAAGTAGATGCTGAGCGACAAGGGCAATTTGGAAATTTGCCTACTGGCTTTGAACGTGACGTGGAGGCTAGTATGTTTCCTTCATATGAGGCAGGTGTGTTTTGTTGGCATGGAGAAAGCAGTGATCCTACAAATCAAATTGTTCCTTCCGATACGTCATCATTGAGAGATTTTGGCGAGGTAGTTTCAGCTGAAGATGGAAGTTTTACCATCCCTGGAACTGGAACTCAAGCCAATTTTAACAACGAAGGGAAACCATCAAACTCTTTTAACTCTGAAAACTTATCTCCTACTCCTAAAGCTACTCCATATGAGTTAACAAGTCATGAAAGAGATTCAGCATTATTGCGATACAGAGAGAAGAAGAAAACCAGAAGATATGACAAGCACATCAGATATGAATCACGAAAAGTTCGGGCAGAAAGCAGGATGAGAATTAAGGGTCGGTTTGTCAAAGATGAAACACAAAAATAA

Predicted protein sequences of Glyma10g02621

Limit To All Plant Sequences

>Glyma10g02621.1   sequence type=predicted peptide   gene model=Glyma10g02621   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MMSGSPSPNSKQRTCDYCGDFTALLYCSADSAKLCFFCDRKVHSPNQLFSKHTRAQLCDSCGDSPASVLCSAENSVLCHNCDCEKHKHLASEVHQRKPLEGFSGCPSVTELLTILGLSEKSLLSNEGTSQIDYDLSDLHVWSAPSVNGLEYLITSTASSHKNRKSAFGRHKEEILSQLRELIKLEPDLIHGEVDAERQGQFGNLPTGFERDVEASMFPSYEAGVFCWHGESSDPTNQIVPSDTSSLRDFGEVVSAEDGSFTIPGTGTQANFNNEGKPSNSFNSENLSPTPKATPYELTSHERDSALLRYREKKKTRRYDKHIRYESRKVRAESRMRIKGRFVKDETQK*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain