SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g02050

Feature Type:gene_model
Chromosome:Gm10
Start:1462725
stop:1464859
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g02050
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G16780AT Annotation by Michelle Graham. TAIR10: Ribosomal protein L19e family protein | chr3:5708982-5710249 FORWARD LENGTH=209 SoyBaseE_val: 5.00E-123ISS
GO:0001510GO-bp Annotation by Michelle Graham. GO Biological Process: RNA methylation SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009165GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide biosynthetic process SoyBaseN/AISS
GO:0009220GO-bp Annotation by Michelle Graham. GO Biological Process: pyrimidine ribonucleotide biosynthetic process SoyBaseN/AISS
GO:0042254GO-bp Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0022625GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic large ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG1696 KOG 60s ribosomal protein L19 JGI ISS
PTHR10722Panther 60S RIBOSOMAL PROTEIN L19 JGI ISS
PF01280PFAM Ribosomal protein L19e JGI ISS
UniRef100_C6SXR2UniRef Annotation by Michelle Graham. Most informative UniRef hit: Ribosomal protein L19 n=1 Tax=Glycine max RepID=C6SXR2_SOYBN SoyBaseE_val: 4.00E-149ISS
UniRef100_C6SXR2UniRef Annotation by Michelle Graham. Best UniRef hit: Ribosomal protein L19 n=1 Tax=Glycine max RepID=C6SXR2_SOYBN SoyBaseE_val: 4.00E-149ISS

Expression Patterns of Glyma10g02050
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g02050
ParalogEvidenceComments
Glyma02g01940 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g02050 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g016300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g02050
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g02050
>Glyma10g02050.1   sequence type=CDS   gene model=Glyma10g02050   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGTCTCTGAAACTTCAGAAGCGGCTTGCCGCTAGCGTTCTCAAGTGTGGTAGAGGCAAAGTTTGGCTTGACCCTAATGAGGTCAATGAAATCTCCATGGCTAATTCTCGACAAAACATAAGGAAATTGGTTAAGGATGGTTTCATTATCAGGAAGCCAACTAAGATTCATTCCCGTTCCCGTGCTCGCAGAATGAAGGAGGCCAAGAGGAAGGGACGTCACTCTGGTTATGGTAAGCGTAAGGGTACAAGAGAGGCTAGGCTCCCCACCAAAATCCTTTGGATGAGGAGGATGCGTGTCCTCAGACGATTGCTCCGCAAGTACAGGGAAGCAAAGAAGATTGACAAGCATATGTACCATGATATGTACATGAAGGTAAAGGGTAATGTCTTCAAGAACAAGAGAGTCTTGATGGAGAGCATACACAAGTCCAAGGCTGAAAAGGCAAGAGAAAAGACCTTGTCTGACCAGTTTGAGGCAAAGCGTGCCAAGAACAAGGCTAGCAGGGAGAGGAAAAATGCTAGGAGAGAAGAGCGTTTGGCTCAAGGCCCTGGAGAGAAGCCATCAGCAGCCCCAAGTGCTCCATCTGCAATAGCATCCCTGCCAGCCCAAGCATCAAAGAAATCAAAGAAGTGA
Predicted protein sequences of Glyma10g02050
>Glyma10g02050.1   sequence type=predicted peptide   gene model=Glyma10g02050   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVSLKLQKRLAASVLKCGRGKVWLDPNEVNEISMANSRQNIRKLVKDGFIIRKPTKIHSRSRARRMKEAKRKGRHSGYGKRKGTREARLPTKILWMRRMRVLRRLLRKYREAKKIDKHMYHDMYMKVKGNVFKNKRVLMESIHKSKAEKAREKTLSDQFEAKRAKNKASRERKNARREERLAQGPGEKPSAAPSAPSAIASLPAQASKKSKK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo