SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g01760

Feature Type:gene_model
Chromosome:Gm10
Start:1282963
stop:1287534
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g01760
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G14290AT Annotation by Michelle Graham. TAIR10: 20S proteasome alpha subunit E2 | chr3:4764364-4766381 FORWARD LENGTH=237 SoyBaseE_val: 2.00E-171ISS
GO:0006511GO-bp Annotation by Michelle Graham. GO Biological Process: ubiquitin-dependent protein catabolic process SoyBaseN/AISS
GO:0006635GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid beta-oxidation SoyBaseN/AISS
GO:0009853GO-bp Annotation by Michelle Graham. GO Biological Process: photorespiration SoyBaseN/AISS
GO:0051603GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis involved in cellular protein catabolic process SoyBaseN/AISS
GO:0000502GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome complex SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0005839GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome core complex SoyBaseN/AISS
GO:0019773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proteasome core complex, alpha-subunit complex SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0004175GO-mf Annotation by Michelle Graham. GO Molecular Function: endopeptidase activity SoyBaseN/AISS
GO:0004298GO-mf Annotation by Michelle Graham. GO Molecular Function: threonine-type endopeptidase activity SoyBaseN/AISS
GO:0004540GO-mf Annotation by Michelle Graham. GO Molecular Function: ribonuclease activity SoyBaseN/AISS
GO:0008233GO-mf Annotation by Michelle Graham. GO Molecular Function: peptidase activity SoyBaseN/AISS
KOG0176 KOG 20S proteasome, regulatory subunit alpha type PSMA5/PUP2 JGI ISS
PTHR11599Panther PROTEASOME SUBUNIT ALPHA/BETA JGI ISS
PTHR11599:SF14Panther PROTEASOME BETA/DELTA SUBUNIT JGI ISS
PF00227PFAM Proteasome subunit JGI ISS
PF10584PFAM Proteasome subunit A N-terminal signature JGI ISS
UniRef100_I1L7R0UniRef Annotation by Michelle Graham. Best UniRef hit: Proteasome subunit alpha type n=1 Tax=Glycine max RepID=I1L7R0_SOYBN SoyBaseE_val: 6.00E-174ISS
UniRef100_I1L7R0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Proteasome subunit alpha type n=1 Tax=Glycine max RepID=I1L7R0_SOYBN SoyBaseE_val: 6.00E-174ISS

Expression Patterns of Glyma10g01760
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g01760 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g014300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g01760
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g01760
>Glyma10g01760.1   sequence type=CDS   gene model=Glyma10g01760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTTTCTCACAAGGACTGAGTATGACCGAGGAGTCAACACCTTTTCTCCCGAAGGCCGTTTGTTTCAGGTTGAGTATGCAATCGAAGCCATCAAGCTGGGATCAACTGCGATTGGGTTGAAGACCAAAGAAGGAGTTGTCCTTGCAGTTGAAAAGCGCATCACATCGCCGCTCCTGGAGCCTAGTAGTGTTGAGAAAATTATGGAAATTGATGAGCACATCGGTTGTGCAATGAGTGGGTTGATTGCAGATGCTCGAACACTTGTTGAGCATGCACGGGTGGAAACTCAGAATCACAGGTTCTCCTATGGTGAGCCTATGACTGTTGAGTCCACCACCCAAGCTCTTTGTGATCTAGCCTTGCGTTTTGGTGAAGGTGATGAAGAGTCCATGTCCCGACCATTTGGAGTATCTCTCCTCATTGCTGGTCATGATGAGAATGGACCTAGCTTATACTACACTGATCCATCTGGCACATTTTGGCAATGCAATGGCAAAGCTATTGGTTCAGGGTCAGAAGGTGCAGACAGTTCTCTACAAGAACAATTCAGCAAGGACCTAACCCTTCAAGAAGCCGAGACTATTGCTTTATCCATTTTGAAGCAAGTTATGGAAGAAAAGGTCACTCCCAACAACGTTGACATTGCCAAGGTGGCTCCAACGTATCATCTTTATACACCGTCTGAGGTGGAAGCTGTGATAAGTCGTCTATGA
Predicted protein sequences of Glyma10g01760
>Glyma10g01760.1   sequence type=predicted peptide   gene model=Glyma10g01760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MFLTRTEYDRGVNTFSPEGRLFQVEYAIEAIKLGSTAIGLKTKEGVVLAVEKRITSPLLEPSSVEKIMEIDEHIGCAMSGLIADARTLVEHARVETQNHRFSYGEPMTVESTTQALCDLALRFGEGDEESMSRPFGVSLLIAGHDENGPSLYYTDPSGTFWQCNGKAIGSGSEGADSSLQEQFSKDLTLQEAETIALSILKQVMEEKVTPNNVDIAKVAPTYHLYTPSEVEAVISRL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo