SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g01680

Feature Type:gene_model
Chromosome:Gm10
Start:1217091
stop:1220506
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g01680
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G02610AT Annotation by Michelle Graham. TAIR10: RING/FYVE/PHD zinc finger superfamily protein | chr1:553181-555854 REVERSE LENGTH=221 SoyBaseE_val: 3.00E-62ISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
PTHR23012Panther MEMBRANE ASSOCIATED RING FINGER JGI ISS
PF00097PFAM Zinc finger, C3HC4 type (RING finger) JGI ISS
PF12428PFAM Protein of unknown function (DUF3675) JGI ISS
UniRef100_G7IDR3UniRef Annotation by Michelle Graham. Most informative UniRef hit: E3 ubiquitin-protein ligase MARCH6 n=1 Tax=Medicago truncatula RepID=G7IDR3_MEDTR SoyBaseE_val: 2.00E-104ISS
UniRef100_I1L7Q2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1L7Q2_SOYBN SoyBaseE_val: 2.00E-174ISS

Expression Patterns of Glyma10g01680
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g01680
ParalogEvidenceComments
Glyma02g01630 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g01680 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g013600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g01680
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g01680
>Glyma10g01680.1   sequence type=CDS   gene model=Glyma10g01680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGCTCTCTGTGGTTGCAAGAAACATGGAAGAAGTTGTGTTGCTGGTTGATGATTTGAGATCACTTTCTGGGATTTCTCGCTGTAGAATATGTCATGAAGAAGAATTTGAGAGCTCCAAAACCTTGGAAGCTCCTTGTGCTTGTTCTGGGACAGTTAAGTTTGCTCACAGAGATTGCATTCAGACTTGGTGCAATGAGAAAGGAAATACAACTTGTGAAATATGTCTCCAGCAATATGAATCCGGATATACAGCAGCCCCAAAGAAATCGCAAGTAGCTGATGCAGCAATGACCATTAGGGATAGCATGCAAATTTCAAGGACTGAACAAGAACCGTTAAATACAAGAATAGTGGGTATAGTTGAAGGAAACAATTACTCTGAATGCACGTATGCTTCGGATAGAACCGCAGCTTGTTGTCGATCCCTGGCTTTAGCATTTACACTCATCTTGCTTGTAAGACATCTTTTCGCACTCCTTACAGATGGAATGGAAGATTATCCATTTACAATTCTTACGGTCTTTTTCCTAAGGGCCAGTGGAATTATTATACCCATGTACATAATTATTAAGGCGATCGGAGCCATTCATGACAATATTAAGCGTCACCATCATCAGGATTCTGACGATGACTCATCGATATCTGATGGAGATGATGAAGAAAATGAGACACCAAATGATGAAATTTTAAGACATTCACAATCATAG
Predicted protein sequences of Glyma10g01680
>Glyma10g01680.1   sequence type=predicted peptide   gene model=Glyma10g01680   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MELSVVARNMEEVVLLVDDLRSLSGISRCRICHEEEFESSKTLEAPCACSGTVKFAHRDCIQTWCNEKGNTTCEICLQQYESGYTAAPKKSQVADAAMTIRDSMQISRTEQEPLNTRIVGIVEGNNYSECTYASDRTAACCRSLALAFTLILLVRHLFALLTDGMEDYPFTILTVFFLRASGIIIPMYIIIKAIGAIHDNIKRHHHQDSDDDSSISDGDDEENETPNDEILRHSQS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo