Glyma10g01300 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g01300

Feature Type:	gene_model
Chromosome:	Gm10
Start:	958875
stop:	959738
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma10g01300

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
UniRef100_C6SZA2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SZA2_SOYBN	SoyBase	E_val: 3.00E-83	ISS

Expression Patterns of Glyma10g01300

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma10g01300

Paralog	Evidence	Comments
Glyma02g01250	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma10g01300 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.10g010100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma10g01300

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma10g01300

Limit To All Plant Sequences

>Glyma10g01300.1   sequence type=CDS   gene model=Glyma10g01300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAATACTAAGAAGCGAGAGGTGAGGGAGGGTGAAGATGATGAAGATGAAATGAAGATGGAGAAGTTTTACGCGCTGTTAAGGAGCTTCCGAGACGCGCGTGATCGGCGGCGAAGGGAGTTGGAAAAAGAAAAACACGAGAGCCGCCACAGCTGGAAGAAGATGAAGACCACCGCCGCAACAACCAAGGACAATAAATCACAAGTTTCTTTTGAATTTCAGGACTTCACCACCGAGATTCATTTCAGAAAGCCACCTTTGACTTTTGCAAATCCAGTTGCATCATGTGACACTAGTATCAAAGACGACAACAAAGGTAAGAAGAAGGAACAACAGGATCTTGCTCTCGACCTCAAACTCGCTCTCTAG

Predicted protein sequences of Glyma10g01300

Limit To All Plant Sequences

>Glyma10g01300.1   sequence type=predicted peptide   gene model=Glyma10g01300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENTKKREVREGEDDEDEMKMEKFYALLRSFRDARDRRRRELEKEKHESRHSWKKMKTTAATTKDNKSQVSFEFQDFTTEIHFRKPPLTFANPVASCDTSIKDDNKGKKKEQQDLALDLKLAL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain