SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma10g01250

Feature Type:gene_model
Chromosome:Gm10
Start:913703
stop:915191
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g01250
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G05260AT Annotation by Michelle Graham. TAIR10: Peroxidase superfamily protein | chr1:1529827-1531271 FORWARD LENGTH=326 SoyBaseE_val: 2.00E-94ISS
GO:0006826GO-bp Annotation by Michelle Graham. GO Biological Process: iron ion transport SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0009269GO-bp Annotation by Michelle Graham. GO Biological Process: response to desiccation SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0010054GO-bp Annotation by Michelle Graham. GO Biological Process: trichoblast differentiation SoyBaseN/AISS
GO:0010106GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion starvation SoyBaseN/AISS
GO:0010167GO-bp Annotation by Michelle Graham. GO Biological Process: response to nitrate SoyBaseN/AISS
GO:0015706GO-bp Annotation by Michelle Graham. GO Biological Process: nitrate transport SoyBaseN/AISS
GO:0016132GO-bp Annotation by Michelle Graham. GO Biological Process: brassinosteroid biosynthetic process SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0004601GO-mf Annotation by Michelle Graham. GO Molecular Function: peroxidase activity SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
PF00141PFAM Peroxidase JGI ISS
UniRef100_B9SWU3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Cationic peroxidase 1, putative n=1 Tax=Ricinus communis RepID=B9SWU3_RICCO SoyBaseE_val: 3.00E-164ISS
UniRef100_I1L7K9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L7K9_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g01250
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g01250 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g009400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g01250
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g01250
>Glyma10g01250.1   sequence type=CDS   gene model=Glyma10g01250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCAGATTTCTACACATGCTTATAATGCTCTCTAGCCTTGCTCTAATTATCTCAGTTTTGCCATTGGCCTCCGCATCTTTGAAGGTGGACTTCTATAAAACTACGTGCCCATCTGCAGAGGCAATAGTGAAAAGAGCCGTAAACAAAGCCGTTTCTCTCAACCCGGGCATCGCTGCTGGTTTGATAAGAATGCATTTTCATGATTGTTTTGTGAGGGGTTGTGATGGTTCTGTGCTATTAGAATCCACCCAAGGCAACCCATCAGAGAGAGAGCACCCTGCCAACAACCCAAGTTTACGTGGCTTTGAAGTTATCGATGAAGCCAAGGCTGAAATAGAGGCAGAGTGTCCTCACACTGTGTCCTGTGCAGACATTCTTGCCTTTGCTGCTCGAGACAGCTCCAACAAAGTTGGAGGCATAAACTATGTAGTGCCAGCTGGACGCAGAGATGGTCGTGTCTCTAACAGAGACGAAGCTTCACAACTTCCTCGTCCAACATTCAACACACAACAACTCATTAGTAACTTTGAACAAAAAGGGTTGTCTGCAGATGAAATGGTAACACTCTCTGGAGCACATTCTATTGGTGTCTCACATTGTTCCTCCTTCTCCGACCGCTTGTACTCTTTCAATGCCACGTTTCCTCAAGACCCTTCTATGGACACTAAATTTGCCACGTCGTTGAAAAGCAAGTGTCCACCAAGGAGTGATAACACGGTGGAGCTTGATGCTTCCTCGCCTAACCGTTTGGACAACAACTACTACACGATGCTCAATAACCATCGTGGTTTGTTGACCTCAGATCAGACTTTGTTGACCAGCCCCTCAACGAGGCCAATGGTGCTAACCAATGCTAAACATGGTTCGACATGGGCACGCAAGTTTGCTAAGGCAATGGTGCATATGGGTTCCATTGAAGTGCTAACTGGCTCACAAGGAGAGATCAGAACGCGTTGCAGCGTCGTTAATTAA
Predicted protein sequences of Glyma10g01250
>Glyma10g01250.1   sequence type=predicted peptide   gene model=Glyma10g01250   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARFLHMLIMLSSLALIISVLPLASASLKVDFYKTTCPSAEAIVKRAVNKAVSLNPGIAAGLIRMHFHDCFVRGCDGSVLLESTQGNPSEREHPANNPSLRGFEVIDEAKAEIEAECPHTVSCADILAFAARDSSNKVGGINYVVPAGRRDGRVSNRDEASQLPRPTFNTQQLISNFEQKGLSADEMVTLSGAHSIGVSHCSSFSDRLYSFNATFPQDPSMDTKFATSLKSKCPPRSDNTVELDASSPNRLDNNYYTMLNNHRGLLTSDQTLLTSPSTRPMVLTNAKHGSTWARKFAKAMVHMGSIEVLTGSQGEIRTRCSVVN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo