SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma10g00300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma10g00300): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma10g00300

Feature Type:gene_model
Chromosome:Gm10
Start:97409
stop:103655
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma10g00300
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G41500AT Annotation by Michelle Graham. TAIR10: WD-40 repeat family protein / small nuclear ribonucleoprotein Prp4p-related | chr2:17304319-17306855 REVERSE LENGTH=554 SoyBaseE_val: 0ISS
GO:0000085GO-bp Annotation by Michelle Graham. GO Biological Process: G2 phase of mitotic cell cycle SoyBaseN/AISS
GO:0000398GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA splicing, via spliceosome SoyBaseN/AISS
GO:0000741GO-bp Annotation by Michelle Graham. GO Biological Process: karyogamy SoyBaseN/AISS
GO:0001709GO-bp Annotation by Michelle Graham. GO Biological Process: cell fate determination SoyBaseN/AISS
GO:0006312GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic recombination SoyBaseN/AISS
GO:0006396GO-bp Annotation by Michelle Graham. GO Biological Process: RNA processing SoyBaseN/AISS
GO:0007267GO-bp Annotation by Michelle Graham. GO Biological Process: cell-cell signaling SoyBaseN/AISS
GO:0008380GO-bp Annotation by Michelle Graham. GO Biological Process: RNA splicing SoyBaseN/AISS
GO:0009553GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac development SoyBaseN/AISS
GO:0009560GO-bp Annotation by Michelle Graham. GO Biological Process: embryo sac egg cell differentiation SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0016571GO-bp Annotation by Michelle Graham. GO Biological Process: histone methylation SoyBaseN/AISS
GO:0016579GO-bp Annotation by Michelle Graham. GO Biological Process: protein deubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005681GO-cc Annotation by Michelle Graham. GO Cellular Compartment: spliceosomal complex SoyBaseN/AISS
GO:0016607GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nuclear speck SoyBaseN/AISS
GO:0080008GO-cc Annotation by Michelle Graham. GO Cellular Compartment: CUL4-RING ubiquitin ligase complex SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
KOG0272 KOG U4/U6 small nuclear ribonucleoprotein Prp4 (contains WD40 repeats) JGI ISS
PTHR19846Panther WD40 REPEAT PROTEIN JGI ISS
PF00400PFAM WD domain, G-beta repeat JGI ISS
PF08799PFAM pre-mRNA processing factor 4 (PRP4) like JGI ISS
UniRef100_B9SVT1UniRef Annotation by Michelle Graham. Most informative UniRef hit: U4/U6 small nuclear ribonucleoprotein Prp4, putative n=1 Tax=Ricinus communis RepID=B9SVT1_RICCO SoyBaseE_val: 0ISS
UniRef100_I1L7B7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L7B7_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma10g00300
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma10g00300 not represented in the dataset
Glyma10g00300 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma10g00300 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.10g000800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma10g00300
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma10g00300
>Glyma10g00300.1   sequence type=CDS   gene model=Glyma10g00300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGTAGAGAAGGAAAATACCACATCAGCTATTACTGCAGAACCCTCTGTATCTGCCTCTGATGGTCAAGATCCTGTTTCTTCTGTTAATGCATCTTTACCGGATCCAATACAACCTGTTATTCCACAGGTTATTGCACCTTCTGTTGTACCTCCTTTAGCTCCAATTCCTGCACTTCCTCCCCCTCGCCCTCTGGCACCGCTTCCAGTTCGGCCACCGGTCATTAGGCCACCTGTGCCACAAAATGGTGAGGTTGGATCAAGTGACTCGGATTCAGACAATGATGACTCAAATGCAAGAATTAACCAGGGGGGCGGGGAGTATGAGATATCCGAAGAGAGTAGACTGGTGAGAGAGCGGCAGGAAAAGGCAATGCAGGAGCTCATGATGAAGAGGCGTGCTGCTGCTCTTGCTGTTCCTACGAATGATATGGCCGTGCGAGCTCGGCTTCGACATCTTGGTGAACCGATAACTCTGTTTGGTGAGAGGGAGATGGAGAGACGGGACAGATTGCGGATGATTATGGCGAAGCTGGATGCAGAAGGTCAGCTGGAGAAGCTGATGAAAGCTCATGAGGAAGAAGAGGCTGCAGCTTCTGCTTCGATAGATGAGGCTGAGGAAGAACTGCAGTATCCTTTTTACACTGAAGGGTCAAAGGCTCTCCTCGATGCCAGAATTTATATTGCTAAATATTCTTTGACAAGGGCTGCATTACGAATTCAACGTGCACAGAGAAGAAGGGATGATCCAGATGAAGATATGGATGCAGAGATGAATTGGGCATTGAAGCAGGCTGGGAATTTGAGTCTTGAATTCAGTGAAATTGGAGATGATCGGCCACTTTCTGGTTGCTCCTTCTCAAGGGATGGAAAATGGCTTGCTACCTGTTCTCTGACAGGAGCTTCCAAGTTGTGGAGCATGCCCAAAATAAAAAAGCATTCCAGCTTTAAGGGTCACACAGAGCGTGCTACTGATGTTGCTTATTCTCCTGTTCATGATCATTTAGCAACTGCCTCTGCTGATCGAACAGCAAAGTATTGGAATCAAGGATCTCTTTTGAAGACATTTGAGGGTCATCTAGACCGTCTTGCACGCATTGCCTTCCATCCATCAGGGAAGTACCTGGGCACTGCTAGCTTTGACAAGACATGGAGATTATGGGACATAGAAACAGGAGACGAGTTGCTTCTTCAAGAAGGCCATAGTAGAAGTGTATATGGTTTGGCTTTCCACAATGATGGATCATTGGCTGCATCTTGTGGACTAGACTCCCTGGCTCGTGTTTGGGACCTCCGAACTGGAAGAAGTATCCTTGCACTGGAAGGTCATGTCAAACCGGTTCTCGGCATCAGTTTTTCACCCAATGGATATCATCTAGCCACGGGTGGTGAAGACAACACTTGTCGGATTTGGGATTTGAGGAAGAAGAAATCCTTTTATACTATTCCTGCTCACTCTAATTTAATTTCACAAGTTAAATTTGAGCCACAAGAAGGTTACTTTTTGGTAACTGCCTCGTATGATATGACTGCTAAGGTTTGGTCAGGCCGTGACTTTAAGCCTGTGAAGACACTATCAGGGCATGAAGCTAAAGTTACTTCTGTGGATGTTCTTGGAGATGGCGGGTATATTGTTACCGTCTCCCATGATCGCACCATAAAGCTGTGGTCCAGCAATACGACTGACGAACAAGCTATGGATGTTGACTAA
Predicted protein sequences of Glyma10g00300
>Glyma10g00300.1   sequence type=predicted peptide   gene model=Glyma10g00300   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVEKENTTSAITAEPSVSASDGQDPVSSVNASLPDPIQPVIPQVIAPSVVPPLAPIPALPPPRPLAPLPVRPPVIRPPVPQNGEVGSSDSDSDNDDSNARINQGGGEYEISEESRLVRERQEKAMQELMMKRRAAALAVPTNDMAVRARLRHLGEPITLFGEREMERRDRLRMIMAKLDAEGQLEKLMKAHEEEEAAASASIDEAEEELQYPFYTEGSKALLDARIYIAKYSLTRAALRIQRAQRRRDDPDEDMDAEMNWALKQAGNLSLEFSEIGDDRPLSGCSFSRDGKWLATCSLTGASKLWSMPKIKKHSSFKGHTERATDVAYSPVHDHLATASADRTAKYWNQGSLLKTFEGHLDRLARIAFHPSGKYLGTASFDKTWRLWDIETGDELLLQEGHSRSVYGLAFHNDGSLAASCGLDSLARVWDLRTGRSILALEGHVKPVLGISFSPNGYHLATGGEDNTCRIWDLRKKKSFYTIPAHSNLISQVKFEPQEGYFLVTASYDMTAKVWSGRDFKPVKTLSGHEAKVTSVDVLGDGGYIVTVSHDRTIKLWSSNTTDEQAMDVD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo