Glyma09g42120 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g42120

Feature Type:	gene_model
Chromosome:	Gm09
Start:	46750155
stop:	46753356
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g42120

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G23280	AT	Annotation by Michelle Graham. TAIR10: TCP family transcription factor \| chr5:7843017-7843769 FORWARD LENGTH=250	SoyBase	E_val: 1.00E-86	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
PTHR11584	Panther	SERINE/THREONINE PROTEIN KINASE	JGI		ISS
PTHR11584:SF275	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF03634	PFAM	TCP family transcription factor	JGI		ISS
UniRef100_G7IE92	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transcription factor PCF2 n=1 Tax=Medicago truncatula RepID=G7IE92_MEDTR	SoyBase	E_val: 9.00E-86	ISS
UniRef100_I1L7A1	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L7A1_SOYBN	SoyBase	E_val: 3.00E-143	ISS

Expression Patterns of Glyma09g42120

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g42120 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g284300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g42120

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g42120

Limit To All Plant Sequences

>Glyma09g42120.2   sequence type=CDS   gene model=Glyma09g42120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCCAACTCTGATGGAGCCACTAACGCCGTCCCTCCCAACGACGCCAACAACAACACAATCGTTGAGTACCAGCAGCGAACCACCACCACCACCACCGCCGCCGCCGCCGCCCTCGCCGTCAAGAAACCGCCTTCCAAGGACCGCCACAGCAAGGTCGACGGCCGCGGGCGCCGCATTCGCATGCCGATCATCTGCGCCGCCCGCGTCTTCCAGCTCACGCGCGAGCTCGGCCACAAGTCCGACGGCCAGACCATCGAGTGGCTCCTCCGCCAGGCGGAACCCTCCATCATCGCCGCTACCGGCTCCGGCACCACTCCGGCGAGCTTCTCCACTGTCTCCGACCACAAGCCCCTCCTCCCTCCCCCTACCCCCTTCATCCTCGGCAAACGCATTCGCCCTGACGACGACTCCGCCGCCAAAGACGACGCCGTCTCGCTCGTCGCCCCCCCCACGCCGCCCGCCCTCTGGGCCCTACCTCCCCGCCCCGACTTCGGCCAGGTCTGGAGCTTCGCCGCCGCGCCCGAACTCGTGTCGGTGTCGCCGCAGAATTCAATGTTTCACCATCACCATCAACACCACCAGCAGCAACAGCAACAGGCCGCCATGGGAGAGGCCTCTGCCGCAAGGCTCGGGAATTACCTCCCCGGCCACCTCAATTTGCTCGCCTCGTTGTCCGGCGGCCACGGGAATTCCGGCCGGCGGGACGACGAGCCTCGCTGA

Predicted protein sequences of Glyma09g42120

Limit To All Plant Sequences

>Glyma09g42120.2   sequence type=predicted peptide   gene model=Glyma09g42120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSNSDGATNAVPPNDANNNTIVEYQQRTTTTTTAAAAALAVKKPPSKDRHSKVDGRGRRIRMPIICAARVFQLTRELGHKSDGQTIEWLLRQAEPSIIAATGSGTTPASFSTVSDHKPLLPPPTPFILGKRIRPDDDSAAKDDAVSLVAPPTPPALWALPPRPDFGQVWSFAAAPELVSVSPQNSMFHHHHQHHQQQQQQAAMGEASAARLGNYLPGHLNLLASLSGGHGNSGRRDDEPR*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain