Report for Sequence Feature Glyma09g41680
Feature Type: gene_model
Chromosome: Gm09
Start: 46344015
stop: 46347260
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma09g41680
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G38480 AT
Annotation by Michelle Graham. TAIR10: Uncharacterised protein family (UPF0497) | chr2:16110960-16111694 REVERSE LENGTH=188
SoyBase E_val: 4.00E-67 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0003674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: molecular function
SoyBase N/A ISS
PF04535 PFAM
Domain of unknown function (DUF588)
JGI ISS
UniRef100_D7LBN4 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: CASP-like protein ARALYDRAFT_321547 n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=CSPLH_ARALL
SoyBase E_val: 2.00E-66 ISS
UniRef100_I1L761 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L761_SOYBN
SoyBase E_val: 7.00E-140 ISS
Expression Patterns of Glyma09g41680
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma09g41680
Paralog Evidence Comments
Glyma18g44020 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma09g41680 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.09g280300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma09g41680
Coding sequences of Glyma09g41680
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma09g41680.1 sequence type=CDS gene model=Glyma09g41680 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTCAAATCTCGACGGTGATTCGCCGAAGATACACGTTGAGACTCCGCCGGTGGCGCCTTCTGCGCCGAGTGAGGGCCACCTCGCGCCGGCGAGCCACGGCGGAATCGGCGGAATCCTGCGGCGGTGGAAGAGGGAGGACTTGATCAAGAGAGGGTCGTTGGGACTGAGAGGGGTCGCTCTGCTTTTCTCTCTGATTTCGTTCTTTATCATGGCCAGCAATAAGCATGGGGATTGGAGAGAGTTCGATAAATATGAAGAGTACAGGTATTTGCTTGCTATAGCGATTTTGTCTAGTTTGTACACTGGAGCCCAAGCGTTCCGTCTACTTCAGGAACTCTCCACCGCAAAACAATTGCTTCAGCCAAGAATGGCAGCTATGATTGACTTTTTTGGTGATCAGATCATTGCATATCTTTTGATATCATCAGCATCTTCAGCAATTCCAATAACAAATAGAATGAGGGAAGGGGCAGACAATATATTCACAGACTCTTCAGCTGCAGCCATTAGCATGTCAATTTTTGCCTTCTTGTGTCTAGCAGTATCAGCCCTCATTTCAGGCTACAAATTATCAACTCAACCTTATATATGA
Predicted protein sequences of Glyma09g41680
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma09g41680.1 sequence type=predicted peptide gene model=Glyma09g41680 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSNLDGDSPKIHVETPPVAPSAPSEGHLAPASHGGIGGILRRWKREDLIKRGSLGLRGVALLFSLISFFIMASNKHGDWREFDKYEEYRYLLAIAILSSLYTGAQAFRLLQELSTAKQLLQPRMAAMIDFFGDQIIAYLLISSASSAIPITNRMREGADNIFTDSSAAAISMSIFAFLCLAVSALISGYKLSTQPYI*