SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g41470

Feature Type:gene_model
Chromosome:Gm09
Start:46141344
stop:46143479
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g41470
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G40435AT Annotation by Michelle Graham. TAIR10: BEST Arabidopsis thaliana protein match is: transcription regulators (TAIR:AT3G56220.1); Has 289 Blast hits to 289 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:16887048-16888407 FORWARD LENGTH=158 SoyBaseE_val: 2.00E-51ISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
UniRef100_B9S4A6UniRef Annotation by Michelle Graham. Most informative UniRef hit: DNA binding protein, putative n=1 Tax=Ricinus communis RepID=B9S4A6_RICCO SoyBaseE_val: 7.00E-53ISS
UniRef100_C6T4E8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6T4E8_SOYBN SoyBaseE_val: 3.00E-103ISS

Expression Patterns of Glyma09g41470
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g41470
ParalogEvidenceComments
Glyma18g44280 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g41470 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g278100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g41470
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g41470
>Glyma09g41470.1   sequence type=CDS   gene model=Glyma09g41470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGCTTCTAGGGAGAAAAGAAGAGCATCTCTGGAAGAAACGTTGCAACAACTTCGCGATGTCACAAACTCCACTGCTTTGAACAAAGCCTCAATTATTGTAGACGCCTCAAAATACATAGAGGAGTTGAAACAAAAAGTGGAGGGACTGAACTCAGAGCTGGAAATCGCGGAATCATCAACAACCACTCAAATTGATGAACTACCTATGGTAATTGTGAAAACCCTAAAAAAGGGTTTCCTGATTAATGTGCTTTTAGAAAAGAATTGCCCTGGAATGCTCGTCTCTATACTCGAAGCCTTCGAAGAACTTGGCCTTGATGTGCTTGATGCTAGGGTTTCTTGTGAAGACAGTTTCCAGCTAGAAGCTGTGGGAAGAGAAAGTCACAAGAACGACAGTGTTGACGCGCAAGTGGTAAAGCAAGCAGTGTTGCAAGCAATCAAGAACGCGGACTAA
Predicted protein sequences of Glyma09g41470
>Glyma09g41470.1   sequence type=predicted peptide   gene model=Glyma09g41470   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAASREKRRASLEETLQQLRDVTNSTALNKASIIVDASKYIEELKQKVEGLNSELEIAESSTTTQIDELPMVIVKTLKKGFLINVLLEKNCPGMLVSILEAFEELGLDVLDARVSCEDSFQLEAVGRESHKNDSVDAQVVKQAVLQAIKNAD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo