Glyma09g41190 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g41190

Feature Type:	gene_model
Chromosome:	Gm09
Start:	45900801
stop:	45901776
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g41190

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G13580	AT	Annotation by Michelle Graham. TAIR10: Disease resistance-responsive (dirigent-like protein) family protein \| chr4:7900427-7901161 FORWARD LENGTH=244	SoyBase	E_val: 5.00E-23	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
PF03018	PFAM	Dirigent-like protein	JGI		ISS
UniRef100_B6TVE6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Dirigent-like protein n=1 Tax=Zea mays RepID=B6TVE6_MAIZE	SoyBase	E_val: 1.00E-22	ISS
UniRef100_I1L712	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1L712_SOYBN	SoyBase	E_val: 5.00E-173	ISS

Expression Patterns of Glyma09g41190

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g41190

Paralog	Evidence	Comments
Glyma18g44650	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g41190 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g275400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g41190

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g41190

Limit To All Plant Sequences

>Glyma09g41190.1   sequence type=CDS   gene model=Glyma09g41190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCAAACTAATGTAAAAAGAAAGCTATGCAACATAATGGCTAGACTTCCTTCTATTTTGGTAAAATTCATGCTACTTTTGTTCATGACCAAGTTTTCTTCAGCTCGAACTCTTGGCAATCCATCCTCTAACCATAACCATGGCCATCACAGAATAACATTTTTAATGAGGGACACGTTCAATAATGGTAGTGCACAATATTCAGAGAAACCAGCCACTACTAAAGTCACTGGTCAACTACCTTTCCCAAAACCTCTAGGCTTTCTTCCTCCTAAAGGAGGGATTCCAATACCACAATCCACTCCAACAACAATTCCACTCACTTCATCGTCCACTCAAACACTTGATCTATCTAGTATTGGCTTCTCTTTTCCCACTAGAGCAACACTCCAAGAGCTAGAGTATGGATCAGTAGCATCAATAGATGAGGAACTACTTATAGATGATGGAGATGAACTACACAAACTTGGAAAAGCACAAGGGGTGTGTGTTGCTAGCTCAGAGGATGGAAGCAGCCATATGGTGGCTATCACAGCAAACTTTTTGAAGGGTGAGTTTGAGGATGGACTGAGGCTTTTTGGAATGCACAAGACTGATGTTTTTGAGTCACATGTTGCAGTTATTGGAGGCACTGGAAAGTACTATGGTGCTAATGGATATGCTGCAGTTAAGGTTGTGGACAAAGTAGGATCTAGTGAAAAAGAAGGGAAAGTGACAAGTTCAAAGTTCCTCTTGTTTGATGTGTATCTTAGTTAA

Predicted protein sequences of Glyma09g41190

Limit To All Plant Sequences

>Glyma09g41190.1   sequence type=predicted peptide   gene model=Glyma09g41190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MQTNVKRKLCNIMARLPSILVKFMLLLFMTKFSSARTLGNPSSNHNHGHHRITFLMRDTFNNGSAQYSEKPATTKVTGQLPFPKPLGFLPPKGGIPIPQSTPTTIPLTSSSTQTLDLSSIGFSFPTRATLQELEYGSVASIDEELLIDDGDELHKLGKAQGVCVASSEDGSSHMVAITANFLKGEFEDGLRLFGMHKTDVFESHVAVIGGTGKYYGANGYAAVKVVDKVGSSEKEGKVTSSKFLLFDVYLS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain