Glyma09g40921 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g40921

Feature Type:	gene_model
Chromosome:	Gm09
Start:	45705904
stop:	45710620
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g40921

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G23660	AT	Annotation by Michelle Graham. TAIR10: polyprenyltransferase 1 \| chr4:12328086-12331359 REVERSE LENGTH=407	SoyBase	E_val: 3.00E-89	ISS
GO:0006744	GO-bp	Annotation by Michelle Graham. GO Biological Process: ubiquinone biosynthetic process	SoyBase	N/A	ISS
GO:0009058	GO-bp	Annotation by Michelle Graham. GO Biological Process: biosynthetic process	SoyBase	N/A	ISS
GO:0009790	GO-bp	Annotation by Michelle Graham. GO Biological Process: embryo development	SoyBase	N/A	ISS
GO:0019243	GO-bp	Annotation by Michelle Graham. GO Biological Process: methylglyoxal catabolic process to D-lactate	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0016021	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane	SoyBase	N/A	ISS
GO:0004659	GO-mf	Annotation by Michelle Graham. GO Molecular Function: prenyltransferase activity	SoyBase	N/A	ISS
GO:0047293	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 4-hydroxybenzoate nonaprenyltransferase activity	SoyBase	N/A	ISS
KOG1381	KOG	Para-hydroxybenzoate-polyprenyl transferase	JGI		ISS
PTHR11048	Panther	PRENYLTRANSFERASES	JGI		ISS
PF01040	PFAM	UbiA prenyltransferase family	JGI		ISS
UniRef100_G7KY71	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Para-hydroxybenzoate-polyprenyltransferase n=1 Tax=Medicago truncatula RepID=G7KY71_MEDTR	SoyBase	E_val: 9.00E-137	ISS
UniRef100_UPI0002338B99	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0002338B99 related cluster n=1 Tax=unknown RepID=UPI0002338B99	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma09g40921

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g40921 not represented in the dataset	Glyma09g40921 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g40921

Paralog	Evidence	Comments
Glyma18g44900	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g40921 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g272700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g40921

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g40921

Limit To All Plant Sequences

>Glyma09g40921.1   sequence type=CDS   gene model=Glyma09g40921   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAACGGCTTTGACCTCCCGTGCTTCCCATAGGTTTCTCAAACCTTCTTCTTCTTCTTCTTCTTCTTCCGTATCACTTTACCCTGTCATCTTCAATCCTCTGATCACCACTCAACAATTCGCAAACCAAAACCCCACTCTAAATCCCCCATTCAAGCCACCCCAGCTCCAAAGTTTCAATTTTGAGTTCCGTAAAACTACTGGGTCTCTCTCAAGTTTCCACCTTGTTGCACACTTGTCCACATGGCATTCCAAGGAGAACAAGAATCAAAGTGGTGATAATGTGAGTAGCAGTGGTGGAGGAGACACCTCTTGGGTTGAATTGTACTTGCCTAGGAAGGTTCAGCCCTATGCTCGACTTGCTCGCCTTGATAAGCCAATTGGGACATGGTTGCTTCTATGGCCTTGTGCCAGATGTACTATTAATGATCTCTTTGATCGGGATATTGATACAATGGTAGAACGGACAAAGTTGAGACAGGTGGCAAGTGGTCTTTTGACACCATTTCAAGGACTTTGTTTTCTTGGTTTTCAATTACTTTTGGGTCTTGGGATTCTTCTACAACTGAATAGTTATAGCCGTGTTTTGGGTGCCTCATCCTTGTTGCTTTTCTTCTCCTATCCCTTCATGAAGAGGTTTACATTTTGGCCCCAAGCCTTTCTTGGTCTGGATCCATCTATTGTGCTGCCACTCTATGCCTCTGGAGTATTTTGGACTCTTGTGTACGATACTATCTATGCACATCAGTGGATTACTGGATTTGAGATTGCATGCCTTGGTGGTCTTGCTGTTAGTGGATTTAATGCTGAAATAGGCTGGCTGTATTATGCATCTCTGGCAGTTGTGTCTGGACACTTAGGCTGGCAAACATGGGCAGTCGACCTTTCTTCACGCACTGACTGCAATAGGAAATTTGTTTCAAATAAGTGGTTTAGAGCTATCATATTTGGTGGAATTCTAGCTGGTGGACTTTCATCCTTGTGGTACTTTTTGCCTTACAGAGAATATACACACACAAGAACAATTTATCAAACATTGTGCGCATACCAAAACTCTGCGCCCTAG

Predicted protein sequences of Glyma09g40921

Limit To All Plant Sequences

>Glyma09g40921.1   sequence type=predicted peptide   gene model=Glyma09g40921   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATALTSRASHRFLKPSSSSSSSSVSLYPVIFNPLITTQQFANQNPTLNPPFKPPQLQSFNFEFRKTTGSLSSFHLVAHLSTWHSKENKNQSGDNVSSSGGGDTSWVELYLPRKVQPYARLARLDKPIGTWLLLWPCARCTINDLFDRDIDTMVERTKLRQVASGLLTPFQGLCFLGFQLLLGLGILLQLNSYSRVLGASSLLLFFSYPFMKRFTFWPQAFLGLDPSIVLPLYASGVFWTLVYDTIYAHQWITGFEIACLGGLAVSGFNAEIGWLYYASLAVVSGHLGWQTWAVDLSSRTDCNRKFVSNKWFRAIIFGGILAGGLSSLWYFLPYREYTHTRTIYQTLCAYQNSAP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain