Glyma09g40740 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma09g40740): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma09g40740): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma09g40740

Feature Type:	gene_model
Chromosome:	Gm09
Start:	45576216
stop:	45577348
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g40740

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G20780	AT	Annotation by Michelle Graham. TAIR10: calmodulin like 42 \| chr4:11133309-11133884 REVERSE LENGTH=191	SoyBase	E_val: 1.00E-69	ISS
GO:0010091	GO-bp	Annotation by Michelle Graham. GO Biological Process: trichome branching	SoyBase	N/A	ISS
GO:0005509	GO-mf	Annotation by Michelle Graham. GO Molecular Function: calcium ion binding	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
KOG0027	KOG	Calmodulin and related proteins (EF-Hand superfamily)	JGI		ISS
PTHR10891	Panther	CALMODULIN	JGI		ISS
PTHR10891:SF43	Panther	CALMODULIN RELATED	JGI		ISS
PF00036	PFAM	EF hand	JGI		ISS
UniRef100_G7KZ68	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Calcium binding protein n=1 Tax=Medicago truncatula RepID=G7KZ68_MEDTR	SoyBase	E_val: 9.00E-90	ISS
UniRef100_UPI0001B63782	UniRef	Annotation by Michelle Graham. Best UniRef hit: UPI0001B63782 related cluster n=1 Tax=unknown RepID=UPI0001B63782	SoyBase	E_val: 2.00E-130	ISS

Expression Patterns of Glyma09g40740

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g40740 not represented in the dataset	Glyma09g40740 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma09g40740 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g270900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g40740

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g40740

Limit To All Plant Sequences

>Glyma09g40740.1   sequence type=CDS   gene model=Glyma09g40740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTAATGGGACAACAGAAAATCGCCCTCGCCCCTCCCTCTTCGTCCTTCCGCCTCCGCAGCCGCAGCCTCAACTCCCTCCGCCTCCGCCGCATCTTCGACATGTTCGACAAGAACGGCGACGGCACCATCACCGTCACGGAGATCAGCCAGGCGCTGAGCCTCCTCGGCCTGGACGCCGACGTGGCGGAGCTGGAGTCCATGACGAAACTCTACATAAGACCCGGCAACGAGGGACTCACGTACGAGGATTTCATGGCGCTGCACGAGTCGCTGGGTGAGACCTACTTTGGGTTGGTCCAGGACGAGGAGGAGCAGCAGCAGGATTCGGATCTGTGGGAGGCGTTTAAGGTTTTCGACGAGAACGGCGACGGTTACATCTCCGCCAAGGAGTTGCAGATGGTGCTGGGGAAACTTGGCTTGGTTGAAGGAAATTTGATGGACAATGTTCATAGGATGATTGGATCTGTCGACACCAACCACGATGGTCGTGTTGATTTCGATGAGTTTAAGGAAATGATGCGCGCCACTATTGTCCCGGCCAGTGCTTGA

Predicted protein sequences of Glyma09g40740

Limit To All Plant Sequences

>Glyma09g40740.1   sequence type=predicted peptide   gene model=Glyma09g40740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVMGQQKIALAPPSSSFRLRSRSLNSLRLRRIFDMFDKNGDGTITVTEISQALSLLGLDADVAELESMTKLYIRPGNEGLTYEDFMALHESLGETYFGLVQDEEEQQQDSDLWEAFKVFDENGDGYISAKELQMVLGKLGLVEGNLMDNVHRMIGSVDTNHDGRVDFDEFKEMMRATIVPASA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain