Glyma09g40450 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g40450

Feature Type:	gene_model
Chromosome:	Gm09
Start:	45372262
stop:	45373678
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma09g40450

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G60890	AT	Annotation by Michelle Graham. TAIR10: protein binding \| chr3:22497024-22497442 REVERSE LENGTH=106	SoyBase	E_val: 1.00E-12	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
UniRef100_B3H6W5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Protein little zipper 2 n=1 Tax=Arabidopsis thaliana RepID=B3H6W5_ARATH	SoyBase	E_val: 7.00E-10	ISS
UniRef100_I1L6T7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1L6T7_SOYBN	SoyBase	E_val: 5.00E-72	ISS

Expression Patterns of Glyma09g40450

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g40450

Paralog	Evidence	Comments
Glyma18g45391	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g40450 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.09g268100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma09g40450

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma09g40450

Limit To All Plant Sequences

>Glyma09g40450.1   sequence type=CDS   gene model=Glyma09g40450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTGCTCTATCTCTTCAAAACAGACCCTTTATTTGGTTCTTCCTCGTCCATGGCCATCTAAAAGACACCACCACAACCACAGGCACCTTCGGTTGGGCATGCTCAACAGAAGGAGGGCACACTTGAAAGAAGCAAGACAAAGGAAAAGGATTGTTGTGGTGAAATCAGAGATTCAGATGAAGAACTTGAAACTGTACATGGAGAACCAAACCATCATAGAGGAGAATGAGAAGTTGAGGAAACAAGCCATGCTTCTGCACAAAGAGAATCAGGCACTCTTGTCTCAGCTCCAAAAGAAGCTTTCAGAACAAAACAACAATACCAACAATAACTAG

Predicted protein sequences of Glyma09g40450

Limit To All Plant Sequences

>Glyma09g40450.1   sequence type=predicted peptide   gene model=Glyma09g40450   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MCSISSKQTLYLVLPRPWPSKRHHHNHRHLRLGMLNRRRAHLKEARQRKRIVVVKSEIQMKNLKLYMENQTIIEENEKLRKQAMLLHKENQALLSQLQKKLSEQNNNTNNN*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain