SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma09g39721

Feature Type:gene_model
Chromosome:Gm09
Start:44754069
stop:44757250
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma09g39721
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G61250AT Annotation by Michelle Graham. TAIR10: myb domain protein 17 | chr3:22671306-22672551 FORWARD LENGTH=299 SoyBaseE_val: 1.00E-119ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009751GO-bp Annotation by Michelle Graham. GO Biological Process: response to salicylic acid stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0048443GO-bp Annotation by Michelle Graham. GO Biological Process: stamen development SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
KOG0048 KOG Transcription factor, Myb superfamily JGI ISS
PTHR10641Panther MYB-RELATED JGI ISS
PF00249PFAM Myb-like DNA-binding domain JGI ISS
UniRef100_G7L3J2UniRef Annotation by Michelle Graham. Most informative UniRef hit: MYB transcription factor n=1 Tax=Medicago truncatula RepID=G7L3J2_MEDTR SoyBaseE_val: 2.00E-152ISS
UniRef100_UPI0002338BB9UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002338BB9 related cluster n=1 Tax=unknown RepID=UPI0002338BB9 SoyBaseE_val: 0ISS

Expression Patterns of Glyma09g39721
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma09g39721 not represented in the dataset
Glyma09g39721 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma09g39721
ParalogEvidenceComments
Glyma18g46480 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma09g39721 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.09g261600 Wm82.a2.v1IGC As supplied by JGI

References for Glyma09g39721
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma09g39721
>Glyma09g39721.1   sequence type=CDS   gene model=Glyma09g39721   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAGGACACCATGTTGTGACAAGAAGGGTTTGAAGAAAGGGCCTTGGACAGCTGAAGAGGATGAAATTCTTTCTAGTTATATCAAGAAAAATGGTGGTCATGGAAGCTGGCGTTCTCTTCCAAGGATGGCAGGTCTTCTTCGTTGTGGCAAGAGTTGCAGGCTTAGGTGGACAAATTATCTCAGACCAGACATTAAGCGTGGTCCCTTTACTCTTGAGGAAGAAAAACTAGTCATACAGCTTCATGGCATCCTAGGAAATAGGTGGGCTGCAATAGCCTCTCAATTACCAGGGAGAACAGACAATGAGATAAAGAACTTATGGAATACTCACTTGAAGAAGCGTCTCAAAAGAATGGGTCTTGATCCCAAAACCCACGAGCCATTGGCCTCATCGACTTACCCTTTTCACAAGGCACCTGCATCAATCTCCACACGCCACATGGCTCAGTGGGAGAGTGCCAGACTCGAAGCCGAGGCCAGGCTCTCGAACGAGTCATCAAGGTTCAGCCACAACAACAATACCAATCCTAATTCAGATAACAATAAAACCACTGATTCTGACTACTTTCTCCGCATTTGGAACTCTGAAGTTGGAGAGGCATTTCGCAATGTTCATCATCACAAAGCTGATAATGACAACAACAAAATCATTACTACTAATACTCCTACTAGTTCCTGCCACAGTCCTCTTTCTGCAGGATCATCTTCCAACAAGTGTGAGTCAATTGCAACAAATGCAGACTTGGCTTCTAATGAACAAGAAATTATCACACCCTCTAGCATTGTCAAACAAGAGTTTGAGTGGGGGACTCGTGGATCCGACTCCTCAAGCTCTAATGACATGGAAGATTCATCAGACACTGCTTTGCAGCTCTTGTTGGATTTCCCTATAAACAATGACATGAGCTTCTTGGAAGGAAACTCTTTTATGTGTCCACTTTAG
Predicted protein sequences of Glyma09g39721
>Glyma09g39721.1   sequence type=predicted peptide   gene model=Glyma09g39721   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGRTPCCDKKGLKKGPWTAEEDEILSSYIKKNGGHGSWRSLPRMAGLLRCGKSCRLRWTNYLRPDIKRGPFTLEEEKLVIQLHGILGNRWAAIASQLPGRTDNEIKNLWNTHLKKRLKRMGLDPKTHEPLASSTYPFHKAPASISTRHMAQWESARLEAEARLSNESSRFSHNNNTNPNSDNNKTTDSDYFLRIWNSEVGEAFRNVHHHKADNDNNKIITTNTPTSSCHSPLSAGSSSNKCESIATNADLASNEQEIITPSSIVKQEFEWGTRGSDSSSSNDMEDSSDTALQLLLDFPINNDMSFLEGNSFMCPL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo